RNA expression in T cells was assessed by extraction of RNA with Ribosol (VWR, Radnor, PA) and preparation of cDNA with the High Capacity cDNA Reverse Transcription kit (Thermo Fisher). Quantitative RT-PCR was performed using the Maxima SYBR Green/ROX kit (Thermo Fisher). Expression was normalized to Actb (β-actin) and shown as relative to WT levels. Primers are listed in Supplemental Table 1 .
Maxima sybr green rox kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Maxima SYBR Green/ROX kit is a ready-to-use solution for real-time PCR analysis. It contains SYBR Green I dye and passive reference dye ROX for quantitative gene expression studies.
Automatically generated - may contain errors
Lab products found in correlation
Ribosol, by Avantor (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
Maxima first strand cdna synthesis kit with dsdnase, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Fastquant rt super mix kit, by Tiangen Biotech (1 mentions)
6 protocols using maxima sybr green rox kit
1
RNA Expression Analysis in T Cells
2
Gene Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using PureLinkTM RNA mini kit (Thermo Fisher Scientific, Waltham, MA, United States), and 250 ng of total RNA were retrotranscribed into cDNA using the Maxima first-strand cDNA synthesis kit with dsDNase (Thermo Fisher Scientific, Waltham, MA, United States). Real-time RT-PCR was performed using the Maxima SyBr green/ROX kit (Thermo Fisher Scientific, Waltham, MA, United States), and fluorescence detection was carried out with Agilent MX300P device and MxPro software (Santa Clara, CA, United States). The relative gene expression (normalized to housekeeping genes) was calculated by the ΔCt method. The Ct (threshold cycle) of the gene of interest was compared with average of the Ct of three different reference genes: peptidylprolyl isomerase A (PPIA), succinate dehydrogenase A (SDHA) and TATA binding protein (TBP), according to the method of Kozera and Rapacz (Kozera and Rapacz, 2013 (link)). Relative quantitative expression was determined as 2–ΔCt. The primers used in this study are presented in Table 2 .
3
Quantification of Nucleolin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ZL216, Control, AHPC, AS1411, or DMSO-treated cells at the concentration of 25 nM for MCF-7 or 50 nM for BT474 for 5 h, and the total RNA was extracted using Eastep (Promega catalog no. LS1040). One microgram of purified RNA was reverse-transcribed in a 20-μL reaction using a FastQuant RT Super Mix Kit (TIANGEN, catalog no. KR106-02). Real-time PCR was then performed by using Maxima SYBR Green/ROX kit (ThermoFisher Scientific) on an Applied Biosystems ABI 7500 Real-Time PCR system with the following primer sequences:
NCL-F: GCACCTGGAAAACGAAAGAAGG;
NCL-R: GAAAGCCGTAGTCGGTTCTGT;
GAPDH-F: ATGTTCGTCATGGGTGTGAA;
GAPDH-R: TGTGGTCATGAGTCCTTCCA.
NCL-F: GCACCTGGAAAACGAAAGAAGG;
NCL-R: GAAAGCCGTAGTCGGTTCTGT;
GAPDH-F: ATGTTCGTCATGGGTGTGAA;
GAPDH-R: TGTGGTCATGAGTCCTTCCA.
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene-specific regions were amplified from cDNA (5–10 ng/μL) with assay primers (100 nM each; Biosearch Technologies (Novato, CA, US)) and Maxima SYBR Green/ROX kit (Thermo Scientific #K0221) on an Applied Biosystems™ StepOne™ Real-Time PCR System 4376357 with the following settings: 25 μL reaction, 95 °C for 10 min, followed by 40 cycles; 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s. Gene expression analysis was performed with Stepone Applied Biosystems software using the relative quantification (ΔΔCt) method. Results are presented as fold change relative to β-actin (2 − ΔΔCt). Primer sequences are listed in Supporting Information Table S2.
5
Quantitative RT-PCR Protocol for CeBGlu Isoforms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR, due to the very high similarity between CeBGlu1 and CeBGlu2 sequences, it was possible to design only one pair of primers common to both isoforms (Supplementary Table 1 ). For CeBGlu expression analysis, SYBR Green I (Maxima SYBR Green/ROX Kit, Thermo Scientific, United States) was used. Amplification was conducted in Light cycler QuantStudio 3 (Thermo Fisher Scientific, United States), according to the manufacturer’s instructions. General thermocycler conditions were 95°C for 10 min; 40 cycles of 95°C for 15 s; 60°C for 30 s; 72°C for 30 s and final extension at 72°C for 10 min. Expression levels of targeted genes were calculated according to the 2–ΔΔCt method (Livak and Schmittgen, 2001 (link)). EF1 gene expression was used as endogenous control to normalize all data (primer sequences are presented within Supplementary Table 1 ). Presented results are obtained from three biological replicates.
6
RNA Expression Analysis in T Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!