The largest database of trusted experimental protocols

Tb green rt pcr kit

Manufactured by Takara Bio

The TB Green RT-PCR kit is a reagent kit designed for real-time reverse transcription polymerase chain reaction (RT-PCR) analysis. It utilizes the TB Green dye to detect and quantify target RNA sequences.

Automatically generated - may contain errors

3 protocols using tb green rt pcr kit

1

MMS-Induced Transcriptional Changes in Yeast

Check if the same lab product or an alternative is used in the 5 most similar protocols
The W303α strain was grown at 30°C until the OD600 reached to 0.5. It was subsequently exposed to 0.15% MMS for 2 h. Total RNA was isolated from the untreated and MMS-treated cells using the acid phenol method as described previously (Suhane et al., 2014 (link)). Further cDNA was synthesized using reverse transcriptase (Omni Script; Qiagen, Hilden, Germany) as described previously (Suhane et al., 2014 (link)). The primer pair, OSB 14 and OSB 16, was used to amplify 307 bp at the 3′ end of ACT1 transcript. To amplify 326 bp at the 3′ end of RAD51, the primer pair OSB 44 and OSB 45 was used. Similarly, to amplify 291 bp at the 3′ end of the AHA1 transcript, the primer pair OSB 216 and OSB 394 was used. Finally, to amplify 276 bp at the 3′ end of SBA1, the primer pair OSB 391 and OSB 445 was used. For real-time RT-PCR, cDNA was diluted (1:50) and used for PCR using a Takara TB Green RT-PCR kit as described earlier (Suhane et al., 2014 (link)). The mean values (±SD) from three independent experiments were plotted using GraphPad Prism 6 software.
+ Open protocol
+ Expand
2

qRT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The leaves of the s1 homozygous plants and transformable receptor plants were sampled, and total RNA was extracted using a Quick-RNA isolation kit (Huayueyang Biotechnology). cDNA was synthesized with a reverse transcription (RT) reagent kit (Invitrogen) according to the manufacturer’s instructions. qRT-PCR was conducted on a CFX96 real-time system (Bio-Rad) with a TB Green RT-PCR kit (Takara). Relative gene expression levels were calculated according to the 2–ΔΔCt relative quantification method with maize ACTIN (Zm00001d010159) as the internal control (Livak and Schmittgen, 2001 (link)).
+ Open protocol
+ Expand
3

Quantification of ADAM9 Expression in Ovarian Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNAs were isolated from the fresh OC tissue and adjacent tissue samples by TRIzol (Invitrogen), and the real‐time quantitative PCR (RT‐qPCR) was performed by the TB Green RT‐PCR kit (TaKaRa). The PCR reaction was performed by an ABI 7500 Real‐Time PCR System (Applied Biosystems), and the condition for PCR was as follows: 95°C, 30 seconds; 40 cycles of 95°C, 5 seconds and 60°C, 30 seconds. The primers were purchased from Sangon Biotech. The relative expression level of ADAM9 was normalized to the expression level of GAPDH by 2−ΔΔCt method. The sequences of the primers were as follows: ADAM9 forward, 5′‐GTGTCCGGTGGTTGCTGT‐3′, ADAM9 reverse, 5′‐AATAGGGCCTAGGGGCTTCTC‐3′; GAPDH forward, 5′‐CTCTGCTCCTCCTGTTCGAC‐3′, GAPDH reverse 5′‐GCGCCCAATACGACCAAATC‐3′.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!