Log In Sign up
The largest database of trusted experimental protocols

Qscript kit

Manufactured by Quantabio
Visit Supplier
Sourced in United States

The QScript kit is a molecular biology tool designed for cDNA synthesis. It contains reagents for the reverse transcription of RNA to cDNA, which is a crucial step in various gene expression studies and downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Tripure reagent, by Roche (2 mentions) Qs5 384 well pcr system, by Thermo Fisher Scientific (1 mentions) Miscript 2 rt kit, by Qiagen (1 mentions) Superscript 4 kit, by Thermo Fisher Scientific (1 mentions) Nucleospin rna extraction kit, by Macherey-Nagel (1 mentions) Onegreen fast qpcr premix, by Ozyme (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Gotaq qpcr master mix, by Promega (1 mentions) Abi 7900ht, by Thermo Fisher Scientific (1 mentions) 7900ht instrument, by Thermo Fisher Scientific (1 mentions)

6 protocols using qscript kit

1

Dose-dependent miRNA-200c regulation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
After transfection, cells were allowed to recover for 8 h in complete growth medium before splitting into 12-well plates (100,000 cells/well). After adhering for 12 h, the cells were treated with 1 or TGP-200c in dose response, vehicle (DMSO), LNA-200c, or LNA-Scramble for 60 h. Total RNA was extracted using the Zymo Quick-RNA Miniprep Kit per the manufacturer’s protocol, including DNase treatment. Reverse transcription (RT) for mature miRNAs was completed with 300 ng of total RNA using a miScript II RT Kit (Qiagen) per the manufacturer’s protocol. RT of pre-miR-200c and mRNAs was completed using qScript Kit (Quanta Bio) with 1000 ng of total RNA per the manufacturer’s protocol. qPCR was completed using a QS5 384-well PCR system (Applied Biosystems) using Power SYBR Green Master Mix according to the manufacturer’s protocol and the Comparative Ct with melt standard method, adjusted for a sample volume of 10 μL. All data were analyzed using the ΔΔCt method previously described (Rao et al., 2013 (link)).
Haniff H.S., Liu X., Tong Y., Meyer S.M., Knerr L., Lemurell M., Abegg D., Aikawa H., Adibekian A, & Disney M.D. (2021). A structure-specific small molecule inhibits a miRNA-200 family member precursor and reverses a type 2 diabetes phenotype. Cell chemical biology, 29(2), 300-311.e10.
+ Open protocol
+ Expand
2

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from mouse or human islets cultured as described above and treated with DNAse I with the Zymogen RNA extraction micro kit (Zymogen, Irvine, CA, USA) according to the product instructions. RNA was converted into cDNA using oligo(dT) primer and the SuperScript IV kit (Invitrogen, Carlsbad, CA, USA) or the qScript kit (QuantaBio, Beverly, MA, USA). qPCR was performed with the ABI 7900HT system and SDS 2.4 software and target gene primers used previously, and relative quantification was performed with the ΔΔCT method using RQ manager 1.2.1, and expression values were normalized to mouse Ppia or human PPIA as a housekeeping gene [3 (link)]. Primer sequences for mouse Il6; Ppia; and human CDKN1A, CDKN2A (p16), and PPIA were as previously described [3 (link)]. Newly designed forward and reverse primer sequences used in this study were as follows (forward and reverse, 5′-3′): Flnb: AACCAGAACTGGAAGATGG and ATGGCTTCTCGGGCATTATC; Mmp2: CCCCGATCTACACCTACACC and GGAGTGACAGGTCCCAGTGT; Igfbp4: ATCGAAGCCATCCAGGAAAG and CAGGGGTTGAAGCTGTTGTT; and Brd4: TTCAGCACCTCACTTCGACC and CTGGTGTTTTTGGCTCCTGC.
Thompson P.J., Shah A., Apostolopolou H, & Bhushan A. (2019). BET Proteins Are Required for Transcriptional Activation of the Senescent Islet Cell Secretome in Type 1 Diabetes. International Journal of Molecular Sciences, 20(19), 4776.
+ Open protocol
+ Expand
3

Quantification of Renilla Luciferase by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAs were isolated using the NucleoSpin RNA extraction kit according the manufacturer instructions (Macherey-Nagel, Düren, Germany) and quantified using a nanodrop 2000 spectrophotometer (Thermofisher, Waltham, MA, USA). Reverse transcription of 250 ng of cytoplasmic RNAs was performed using qScript kit (Quanta Bio, Beverly, MA, USA). mRNA quantification was performed by quantitative PCR with the ONEGreen® FAST QPCR PREMIX (Ozyme, Saint-Cyr-l’École, France) according to the manufacturer instructions. Renilla luciferase (Renilla forward TGGACAATAACTTCTTCGTGAAAAC/ Renilla reverse GCTGCAAATTCTTCTGGTTCTAA) was amplified in parallel with the endogenous housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (GAPDH forward (Human) CGACAGTCAGCCGCATCTT/ GAPDH reverse (Human) CCCCATGGTGTCTGAGCG). The relative copy numbers of Renilla cDNAs were compared to GAPDH using x–ΔCt (where x corresponds to the experimentally calculated amplification efficiency of each primer couple).
Condé L., Allatif O., Ohlmann T, & de Breyne S. (2022). Translation of SARS-CoV-2 gRNA Is Extremely Efficient and Competitive despite a High Degree of Secondary Structures and the Presence of an uORF. Viruses, 14(7), 1505.
+ Open protocol
+ Expand
4

Quantitative Analysis of Circadian Rhythm Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted by using the RNeasy Mini Kit (QIAGEN). Complementary DNA synthesis was performed by using the qScript kit (Quantabio, catalog no. 101414-098), according to the manufacturer’s instructions. qPCR was performed by using the GoTaq qPCR Master Mix (Promega, catalog no. M3001) in the LightCycler 480-Roche System, according to the supplier’s manual. Measurements were normalized to the housekeeping control (GAPDH). Primers used in this study were as follows: CEBPA-F: 5′-CAAGAACAGCAACGAGTACCG-3′, CEBPA-R: 5′-GTCACTGGTCAACTCCAGCAC-3′, PER2-F: 5′-GAAAGCTGTCACCACCATAGAA-3′, PER2-R: 5′-AACTCGCACTTCCTTTTCAGG-3′, PER3-F: 5′-AACACGAAGACCGAAACAGAAT-3′, and PER3-R: 5′-CTCGGCTGGGAAATACTTTTTCA-3′.
Zhang Z.B., Sinha J., Bahrami-Nejad Z, & Teruel M.N. (2022). The circadian clock mediates daily bursts of cell differentiation by periodically restricting cell-differentiation commitment. Proceedings of the National Academy of Sciences of the United States of America, 119(33), e2204470119.
+ Open protocol
+ Expand
5

Macrophage Gene Expression Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Thioglycollate-elicited macrophages were harvested by peritoneal lavage in sterile saline and pooled from 2–4 mice per strain per experiment as previously described(26 (link)). Cells were stimulated with E6020 at concentrations ranging from 0.1 ng/ml – 100 ng/ml for 2 hours after which macrophages were harvested in TriPure reagent (Roche, San Francisco, CA) and frozen at −80° C. RNA was extracted per the manufacturer’s protocol and cDNA was reverse transcribed from 1 μg RNA per sample using Qscript kits (QuantaBio, Beverly, MA)(26 (link)). qRT-PCR was performed on an ABI 7900HT instrument (Applied Biosystems, Waltham, MA) using Power SYBR Green PCR master mix (Applied Biosystems) with primers (Sigma-Aldridge, Inc., St. Louis, MO) for Hprt, Tnf, Il1b, Ifnb1, and Cxcl10(27 (link)). Levels of mRNA for specific genes are reported and statistical analyses performed on negative delta cycle threshold (CT) values, as normal distributions are preserved in this method. Data are displayed as arithmetic mean ± SEM. Conversion to relative gene expression normalized to that of WT unstimulated macrophages (“fold induction”)(28 (link)) are also shown on the right y-axis (Figure 1). The housekeeping gene encoding hypoxanthine-guanine phosphoribosyltransferase (Hprt) was used for normalization of RNA levels within each sample.
Gopalakrishnan A., Richard K., Wahid R., Harley R., Sztein M.B., Hawkins L.D, & Vogel S.N. (2022). E6020, a TLR4 Agonist Adjuvant, Enhances both Antibody Titers and Isotype Switching in Response to Immunization with Hapten-Protein Antigens and Is Diminished in Mice with TLR4-signaling Insufficiency. Journal of immunology (Baltimore, Md. : 1950), 209(10), 1950-1959.
+ Open protocol
+ Expand
6

Quantitative Real-Time PCR Analysis of Macrophage Gene Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Macrophages were harvested in Tripure reagent (Roche) at the indicated time points after stimulation and frozen at −80 oC. RNA was extracted by the manufacturer’s protocol and cDNA reverse synthesized from 1 μg RNA per sample using QScript kits (QuantaBio), as previously described [45 (link)]. qRT-PCR was performed on a 7900HT instrument (Applied Biosystems) using Power SYBR Green PCR master mix (Applied Biosystems) with primers for Hprt, Tnf, Il10, Il1b, Cxcl1, Ifnb1, Cxcl10, and Ccl5 (Sigma, custom synthesis based on published sequences [48 (link)], confirmed in primer BLAST). Fold-induction was normalized relative to Hprt levels and the medium-treated control levels of individual genes using the 2^(-ΔΔCT)-method [49 (link)].
Richard K., Perkins D.J., Harberts E.M., Song Y., Gopalakrishnan A., Shirey K.A., Lai W., Vlk A., Mahurkar A., Nallar S., Hawkins L.D., Ernst R.K, & Vogel S.N. (2020). Dissociation of TRIF bias and adjuvanticity. Vaccine, 38(27), 4298-4308.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!