Sybr green premix ex taq 2 tli rnase h plus

Total RNA was extracted from paraffin-embedded tissue by miRNeasy FFPE Kit (no. 217504, Qiagen, German), and the RNA concentration and purity were measured by NanoDrop® ND-2000, while adjusting the A260/A280 ratio of RNA solution from 1.8 to 2.1. The cDNA synthesis was performed with the miRNA First Strand cDNA Synthesis (tailing reaction) (no. B532451, Sangon, China). The expression of hsa-miR-196b-3p and hsa-miR-196b-5p was detected in the ABI7500 quantitative PCR system (Applied Biosystems, USA) instrument by SYBR Green Premix Ex Taq II (Tli RNase H Plus, Takara, Japan). U6 small nuclear RNA was used as the internal controls. The 20 μl reaction mixture included 10.0 μl SYBR Green Master Mix, 4 μl cDNA template, 0.4 μl ROX Reference Dye, 1.0 μl primer pairs (10 μm), and 4.6 μl deionized water. PCR cycle was performed as follows: initial degeneration for 30 s at 95°C, followed by 40 cycles of 5 s at 95°C and 34 s at 60°C. The relative expression of hsa-miR-196b-3p and hsa-miR-196b-5p was calculated by comparing the cycle threshold (CT) method using the 2^−△△ct method with U6 expression according to [21 (link)]. The primers of hsa-miR-196b-3p were 5′-TCGACAGCACGACACTGCCTTC-3′ (sense) and 5′- GACACGGACCCACAGACA-3′ (antisense), while the hsa-miR-196b-5p primers were 5′-GCACCAGCGTAGGTAGTTTCC-3′ (sense) and 5′-TATGCTTGTTCTCGTCTCTGTGTC-3′ (antisense).

63 paraffin samples from 2021.12 to 2022.2 from the Department of Pathology of West China Hospital of Sichuan University were screened, of which 42 cases were confirmed as DLBCL samples and 21 samples of normal lymphoid tissue hyperplasia. The Ethical Committee of West China Hospital approved this study and waived informed consent. According to the manufacturer’s protocol, total RNA was extracted from FFPE samples and gDNA removed using the RNApure FFPE kit (CW0535, CoWin Bioscience, Beijing, China). HiScript® III All-in-one RT SuperMix was used Perfect for qPCR (R333, Vazyme, NanJing, China) reverse transcription and used cDNA as a template for real-time fluorescence quantification. RT-qPCR was performed with the SYBR® Green Premix Ex Taq™ II (Tli RNaseH Plus) (RR820A, TaKaRa, Beijing, China) on a Real-time PCR Detection System (Bio-rad). Independent experiments are performed in triplicate, ß actin as an internal control. The following primers (Tsingke Biotechnology Co., Ltd., Beijing, China) were used: FCER1G: $\text{F }5\text{′}-\text{TCTTCTTTGGCTTCTGGTTCTTC}-3\text{′}$
$\text{R }5\text{′}-\text{GGGTTCTCCCTTCCCATATTTTA}-3\text{′}$
ACTIN: $\text{F }5\text{′}-\text{CCGCGAGAAGATGACCCAGA}-3\text{′}$
$\text{R }5\text{′}-\text{GATAGCACAGCCTGGATAGCA}-3\text{′}$