Proteinase k

Manufactured by Zymo Research

Sourced in United States

Proteinase K is a broad-spectrum serine protease enzyme commonly used in molecular biology and biochemistry applications to digest and degrade proteins. It is isolated from the fungus Engyodontium album and demonstrates high activity across a wide range of temperatures and pH levels.

Automatically generated - may contain errors

Lab products found in correlation

Digestion buffer, by Zymo Research (3 mentions) Anti ha antibody, by Abcam (1 mentions) H3k27ac, by Diagenode (1 mentions) Anti flag antibody, by Merck Group (1 mentions) Hdac1, by Diagenode (1 mentions) H3k27me3, by Cell Signaling Technology (1 mentions) Protein a g bead, by Thermo Fisher Scientific (1 mentions) Dna clean and concentration kit, by Zymo Research (1 mentions) Geno grinder 2010, by SPEX (1 mentions) Zr 96 fungal bacterial dna kit, by Zymo Research (1 mentions) Lysis solution, by Zymo Research (1 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions) Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (1 mentions) Dna clean concentrator 5 kit, by Zymo Research (1 mentions) Normal serum, by Thermo Fisher Scientific (1 mentions) Inverted fluorescence microscope, by Leica (1 mentions) Alexa fluor 488 labeled goat anti rabbit igg, by Beyotime (1 mentions) Dna miniprep kit, by Zymo Research (1 mentions) Dithiothreitol (dtt), by Thermo Fisher Scientific (1 mentions) Direct zol rna miniprep kit, by Zymo Research (1 mentions)

22 protocols using proteinase k

Determining Viral Titers from Crude Lysates

Check if the same lab product or an alternative is used in the 5 most similar protocols

Production titers of crude lysate samples were determined as follows. 2 μl of the crude lysates were mixed with PBS, supplemented with 2mM MgCl₂, and 0.1 μl ultrapure Benzonase Nuclease (Sigma-Aldrich) was added. Samples were incubated at 37 °C for 30 min to digest DNA that was not protected by AAV capsids. Next, 5 μl 10x Proteinase K buffer (100 nM Tris-HCl, pH 8.0, 10 mM EDTA, and 10 % SDS) and 1 μl Proteinase K (20 mg/ml; Zymo Research) were added inhibiting the Benzonase and digesting proteins including the AAV capsid to free the ssDNA. Afterwards, samples incubated for 20 min at 50 °C, followed by heat inactivation of the Proteinase K for 5 min at 95 °C. The viral ssDNA was purified using the DNA Clean & Concentrator-5 Kit (Zymo Research) according to the manufacturer’s instructions for ssDNA purification. All samples were diluted 1:500 in H₂O prior to qPCR, which was run using a QuantStudio5 Real-Time PCR System (Applied Biosystems) and by using the PowerUp SYBR Green Master Mix (Applied Biosystems), following the manufacturer’s instructions. A primer set binding within the CMV-enhancer (forward: AACGCCAATAGGGACTTTCC, reverse: GGGCGTACTTGGCATATGAT; (29 (link)) of the transgene expression cassette was used. To calculate the viral titer in vg/ml, a plasmid standard at a known concentration also containing a CMV-enhancer was used.

Hoffmann M.D., Gallant J.P., LeBeau A.M, & Schmidt D. (2024). Unlocking Precision Gene Therapy: Harnessing AAV Tropism with Nanobody Swapping at Capsid Hotspots. bioRxiv.

+ Open protocol

+ Expand

Targeted Next Generation Bisulfite Sequencing of Mammary Tumor Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DNA methylation analysis was performed with the targeted Next Generation Bisulfite Sequencing (tNGBS) by EpigenDx, Inc. DNA was extracted from 10 mg of mammary tumors using M-digestion Buffer (1×; ZymoResearch, CA) and proteinase K (ZymoResearch, CA) (20 mg/ml). The lysate was incubated for 2 hours at 65 °C, frozen and sent to EpigenDx. tNGBS was designed to cover all CpGs sites within about 4000 bases in the regions of interest. Region from −1500 to +1000 including promoter #1 and exon 1, and gene body region from +10000 to +15000 including intron 1, intron 2 and promoter #2 were covered (Supplementary Fig. 6).

Andrade F.D., Nguyen N.M., Warri A, & Hilakivi-Clarke L. (2019). Reversal of increased mammary tumorigenesis by valproic acid and hydralazine in offspring of dams fed high fat diet during pregnancy. Scientific Reports, 9, 20271.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation and Sequencing Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin immunoprecipitation was performed using a previously described protocol (53 (link)). Briefly, 1 million cells were fixed with 1% formaldehyde and sonicated with Covaris E220 or Bioruptor Plus. Sonicated chromatin was then incubated with antibodies against target proteins or histone posttranslational modifications overnight. Protein A/G beads (Thermo Fisher) were added to the sonicated chromatin for 2 hours. After washes with low-salt, high-salt, and LiCl wash buffer, beads were decross-linked with proteinase K (Zymo Research) at 55°C overnight. Pulled-down DNA was extracted by the DNA clean and concentration kit (Zymo Research). Libraries were prepared using the Swift Bioscience Acce-NGS 2G plus kit according to the manufacturer's manual. The libraries were sequenced 150-bp paired-end on HiSeq 2000 by Fulgent Genomics.
Chromatin immunoprecipitation sequencing (ChIP-seq) antibodies used in this study included H3K27ac (Diagenode, Rabbit Polyclonal, C15410196, RRID:AB_2637079), H3K27me3 (Cell Signaling Technology, Rabbit Monoclonal, 9733, RRID:AB_2616029), Pol II S5P (Diagenode, Mouse Monoclonal, C15200007, RRID:AB_2713926), HDAC1 (Diagenode, Rabbit Polyclonal, C15410325, RRID:AB_2921266), anti-FLAG antibody (Sigma-Aldrich, mouse monoclonal, F1804, RRID:AB_262044), and anti-HA antibody (Abcam, Rabbit Polyclonal, ab9110, RRID:AB_307019).

Wang X.Q., Fan D., Han Q., Liu Y., Miao H., Wang X., Li Q., Chen D., Gore H., Himadewi P., Pfeifer G.P., Cierpicki T., Grembecka J., Su J., Chong S., Wan L, & Zhang X. (2022). Mutant NPM1 Hijacks Transcriptional Hubs to Maintain Pathogenic Gene Programs in Acute Myeloid Leukemia. Cancer Discovery, 13(3), 724-745.

+ Open protocol

+ Expand

Bovine Colostrum and Milk DNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Colostrum and milk samples collected from 54 multiparous cows were subjected to genomic DNA extraction using the ZR-96 Fungal/Bacterial DNA Kit (Zymo Research, Irvine, CA, USA) following modified protocols of the manufacturer as follows: 1.5 mL of each sample was centrifuged at 12,000×g for 20 min at 4 °C. Supernatants were carefully removed and 200 μL of TE buffer and 300 μL of 0.5 M EDTA (pH = 8) were added to the pellet. The mixture was incubated for 20 min at room temperature and again centrifuged at 12,000×g for 10 min. Supernatants were removed and pellets were resuspended by adding 200 μL of PBS buffer and vortexing for 30 s. Next, 1 g of autoclaved 0.5 mm silica beads, 400 μL of Lysis Solution (Zymo Research, CA, USA), and 18 μL of 20 mg/mL Proteinase K (Zymo Research, CA, USA) were added to each tube and incubated in a heated shaker at 45 °C for 45 min. Tubes were then vortexed for 2 min using a 2010 GenoGrinder (SPEX SamplePrep, NJ, USA) at 1700 stroke per minutes. Then, 400 μL of the resulting mixture was then transferred to the deep-well plate of the Fungal/Bacterial DNA Kit and extraction process continued following manufacturer protocol. Negative controls (n = 3) were included in the extraction process by replacing 1 mL of sterile water instead of colostrum/milk samples.

Derakhshani H., Plaizier J.C., De Buck J., Barkema H.W, & Khafipour E. (2018). Association of bovine major histocompatibility complex (BoLA) gene polymorphism with colostrum and milk microbiota of dairy cows during the first week of lactation. Microbiome, 6, 203.

+ Open protocol

+ Expand

Histological Analysis of Enpp1 in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

The knee joints of WT and Enpp1^−/− mice were harvested and stored in 10% formalin. Then knee joints were decalcified in 0.5 M EDTA (pH 7.4) for 4 weeks at 4 °C, changing EDTA every 2 days. The joints were made into 6-μm sections after embedding with paraffin. After deparaffinizing, the sections were incubated with proteinase K (20 μg/mL, Zymo Research, USA) for 10 min at room temperature and blocked in 5% normal serum (10,000 C, Thermo Fisher Scientific, USA) in PBS-T (0.4% Triton X-100 in PBS). Subsequently, the sections were incubated with antibodies against Enpp1 (1:1000, Bioss Antibodies Inc, Woburn, MA, USA) for 12 h and secondary antibody (Alexa Fluor 488 Labeled Goat Anti-Rabbit IgG, Beyotime, China) for an hour, at 37 ℃. Finally, the cover glass was placed on the section after adding the mounting medium. The images were captured by an inverted fluorescence microscope (Leica) and then the proportion of Enpp1-positive chondrocytes (green fluorescence) was analyzed by ImageJ.
The 6-μm sections described previously were stained with Hematoxylin & Eosin and Safranin O/Fast Green according to standard procedures.

Gao Z., Wang Q., Guo K., Li X, & Huang Y. (2023). Enpp1 deficiency caused chondrocyte apoptosis by inhibiting AMPK signaling pathway. Journal of Orthopaedic Surgery and Research, 18, 462.

+ Open protocol

+ Expand

Metagenomic DNA Extraction from Terasi

Check if the same lab product or an alternative is used in the 5 most similar protocols

Extraction of DNA was done using the DNA miniprep kits (Zymoresearch Catalog 4300), following the manufacturer’s instructions. Briefly, 300 µg of the low-salt terasi were placed into a lysis tube containing lysis buffer. Proteinase K (Zymoresearch, Irvine, CA, USA) (10 µL) was added, and the mixture was incubated at 55 °C for 60 min. The PicoGreen method, using the Victor 3 fluorometer, was used for quantifying the metagenomic DNA.

Helmi H., Astuti D.I., Putri S.P., Sato A., Laviña W.A., Fukusaki E, & Aditiawati P. (2022). Dynamic Changes in the Bacterial Community and Metabolic Profile during Fermentation of Low-Salt Shrimp Paste (Terasi). Metabolites, 12(2), 118.

+ Open protocol

+ Expand

Saliva Collection and RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Saliva was collected using the DNA/RNA Shield Saliva Collection Kit (Zymo Research) following the manufacturer’s protocol. 1–2 ml of saliva/Shield mix was incubated with DTT (Life Technologies) following the U.S. Department of Health and Human protocol (https://www.cdc.gov/coronavirus/2019-ncov/downloads/processing-sputum-specimens.pdf). The samples were then treated with Proteinase K (Zymo Research) following the manufacturer’s protocol. RNA was extracted using the Direct-zol RNA Miniprep Kit (Zymo Research).

Jain M.K., De Lemos J.A., McGuire D.K., Ayers C., Eitson J.L., Sanchez C.L., Kamel D., Meisner J.A., Thomas E.V., Hegde A.A., Mocherla S., Strebe J.K., Li X., Williams N.S., Xing C., Ahmed M.S., Wang P., Sadek H.A, & Schoggins J.W. (2022). Atovaquone for treatment of COVID-19: A prospective randomized, double-blind, placebo-controlled clinical trial. Frontiers in Pharmacology, 13, 1020123.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two-thousand ng of total DNA in a 50 μl volume was mixed with 5 μl 10x CutSmart buffer and 1 μl Xho1 (NEB, Cat # R0146S). The mixture was incubated at 37 °C for 4 hours and heat-inactivated at 65 °C for 20 minutes. Five μl of the mixture was set aside as input DNA and the remaining mixture was split into 1 ml PBST (10 mM NaH₂PO₄, 175 mM NaCl, pH 7.4, 0.1% Triton X-100) and incubated overnight at 4 °C with 2 μg anti-ssDNA antibody (Sigma, Cat #MAB3034, Clone 16-19) or 2 μg normal mouse IgG (Sigma, Cat # 12–371). The DNA-antibody complex was captured using 20 μl Dynabeads Protein G (Thermo Fisher, Cat # 10004D) for 2 hours at 4 °C. The beads were sequentially washed three times with PBST. The DNA was eluted by 80 μl elution buffer (10 mM Tris-HCl, 300 mM NaCl, 5mM EDTA, 0.5% SDS, pH 8.0) containing 5 μg Proteinase K (Zymo Research, Cat # D3001–2-20) at 55 °C for 1 hour with vigorous vortexing. The eluted DNA was then purified by Phenol/Chloroform (Thermo Fisher, Cat #15593–049) and qPCR was performed by using SsoFast EvaGreen (Bio-Rad, Cat # 1725204) on a CFX96 Real-time System. Fold changes were calculated using the ΔΔCt method, with input DNA used for normalization and set the sh-white & sh-aub control as 1.

Durmaz E, & Klaenhammer T.R. (2000). Genetic Analysis of Chromosomal Regions of Lactococcus lactis Acquired by Recombinant Lytic Phages. Applied and Environmental Microbiology, 66(3), 895-903.

+ Open protocol

+ Expand

TUNEL Assay for Cell Death Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TUNEL assay was performed on disc tissue sections using the “In situ cell death detection” Kit (TMR red, Sigma). Briefly, sections were deparaffinized and rehydrated before permeabilization with Proteinase K (20μg/mL, D3001–2-5, Zymo Research) for 15 min at room temperature. Then, the TUNEL assay was carried out following the manufacturer’s protocol. Coverslips were mounted with Fluoroshield. All sections were visualized using a Leica fluorescence microscope (DMI6000B, Leica). Three mice were evaluated in each group.

Li X., Yang S., Han L., Mao K, & Yang S. (2020). Ciliary IFT80 is essential for intervertebral disc development and maintenance. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(5), 6741-6756.

+ Open protocol

+ Expand

Saliva Sample Inactivation and RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PKTP buffer was composed of 0.1% Tween 80 (BP338-500 Fisher Scientific, Waltham, MA, USA), 5 mg/mL Poly Vinyl Sulfonic Acid sodium salt solution (278416 Millipore Sigma, St. Luis, MI, USA), and 200 µg/mL Proteinase K (Zymo Research, Irvin, CA, USA) in Ca- and Mg-free Dulbecco’s Phosphate-Buffered Saline buffer (DPBS L0615-500 Biowest, Riverside, MO, USA). The saliva samples were mixed with PKTP on a 1:1, 2:1, or 3:1 saliva:PKTP ratio and was heat inactivated (10 min at 96 °C) on a SimpliAmp Thermal cycler (Applied Biosystems, Waltham, MA, USA). Then, 4 µL of the inactivated saliva:PKTP mix was used for single- or multiplex RT-PCR reactions. The PKTP buffer was freshly prepared for all experiments except for the stability tests.

Bustos-Garcia B., Garza-Manero S., Cano-Dominguez N., Lopez-Sanchez D.M., Salgado-Montes de Oca G., Salgado-Aguayo A., Recillas-Targa F., Avila-Rios S, & Valdes V.J. (2022). Development and Testing of a Low-Cost Inactivation Buffer That Allows for Direct SARS-CoV-2 Detection in Saliva. Vaccines, 10(5), 730.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!