Total RNA was extracted by using the RNAeasy Mini Kit (Qiagen) and retrotranscribed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem). The cDNAs (50 ng/replicate) were then added to a mix containing SYBRTM Green (Applied Biosystems; 12,5 µL/replicate), H2O, for a final volume of 20 µL/well and forward and reverse primers 1 µM each (CFTRdw10 5′acttctaatggtgatgacagcc3′/CFTRup9 5′-atccagcaaccgccaacaact3′; GFP-F 5’agaacggcatcaaggtgaac3’/ GFP-R 5’tgctcaggtagtggttgtcg3’). Samples were analyzed with the thermocycler Applied Biosystems 7300 Real Time PCR System 96-well qPCR (15″ at 95 °C, 60″ at 60 °C, for 40 cycles) [36 (link),37 (link)].
Sybrtm green
Manufactured by Thermo Fisher Scientific
Sourced in United States
SYBR™ Green is a fluorescent dye used in real-time PCR (qPCR) applications to detect and quantify DNA amplification. It binds to double-stranded DNA, emitting a fluorescent signal that can be measured to determine the amount of target DNA present in a sample.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Real time pcr system, by Bio-Rad (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Rnaeasy mini kit, by Qiagen (1 mentions)
Rneasy mini or micro kit, by Qiagen (1 mentions)
Applied biosystems 7300 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Qiashredder homogenizer, by Qiagen (1 mentions)
Taqman, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Trizoltm reagent, by Thermo Fisher Scientific (1 mentions)
Turbotm dnase, by Thermo Fisher Scientific (1 mentions)
Primescripttm rt reagent kit, by Takara Bio (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Hiseq 2500, by Illumina (1 mentions)
Cellulose dialysis bag, by Merck Group (1 mentions)
Fluorescein, by Thermo Fisher Scientific (1 mentions)
Pen strep, by Merck Group (1 mentions)
Plasmid mega kit, by Qiagen (1 mentions)
Tnbsa assay, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum gibcotm, by Thermo Fisher Scientific (1 mentions)
7 protocols using sybrtm green
1
Quantitative Real-Time PCR Assay
2
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from transfected cells was extracted using the RNeasy Mini or Micro Kit (QIAGEN, Milan, Italy), depending on the number of cells according to the manufacturer’s instructions, and retrotranscribed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, ThermoFisher Scientific, Monza, Italy). The cDNAs (50–75 ng/replicate) were then added to a mix containing SYBRTM Green (Applied Biosystems™; ThermoFisher Scientific, Monza, Italy; 12.5 µL/replicate), forward and reverse primers (1 µM each) (Table S1 ), and H2O for a final volume of 15–20 µL/well. Samples were analyzed with the thermocycler Applied Biosystems 7300 Real Time PCR System (ThermoFisher Scientific, Monza, Italy) (15″ at 95° C, 60″ at 60° C, for 40 cycles).
3
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was quantified by quantitative real time PCR. RNA was isolated using RNeasy® Mini Kit (#74106, Qiagen) according to manufacturer's protocol, and QIAshredder homogenizer (#79656, Qiagen) to increase yield of quantification of RNA. cDNA was synthesized with High Capacity cDNA Reverse Transcript Kit (#4368814). Real time PCR was performed using both Taqman ® (#4444557) and SYBR TM Green (#A25742, all purchased from Applied Biosystems) assays. Ct values were normalized to β-actin (for Taqman ® ) and gapdh (for SYBR TM Green), and showed as expression relative to control.
List of probes and primers used are in Supplemental Table 3.
List of probes and primers used are in Supplemental Table 3.
4
Quantitative Analysis of TF Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol TM reagent (Invitrogen) from 100 mg ground samples of Arabidopsis seedlings. 2 units TURBO TM DNase (Invitrogen) was added to mitigate DNA contamination prior to first-strand cDNA synthesis with PrimeScript TM RT reagent kit (Takara Bio) from approximately 1 μg total RNA. Quantitative RT-PCR was performed with 7900 HT fast realtime PCR system (Applied Biosystems) using gene-specific primers of candidate TFs (Table S2) and fluorescent dye SYBR TM Green (Applied Biosystems).
Expression values relative to ACT2 were calculated with the comparative ΔΔCt method (Schmittgen and Livak, 2008) .
Expression values relative to ACT2 were calculated with the comparative ΔΔCt method (Schmittgen and Livak, 2008) .
5
Temporal gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA derived from four times (8, 15, 23, 31 dayss) was isolated using Trizol (Invitrogen, Carlsbad, CA, USA), RNA concentration was measured by its absorbance at 260 nm, ratio 260 nm/280 nm was assessed, and its integrity confirmed by electrophoresis in agarose 1% (w/v) gels. Samples of cDNA were amplified by PCR using SYBRTM Green (ThermoFisher CAT: 4312704, Waltham, MA, USA) in Real-Time PCR Systems (CFX96 BioRad, Herules, CA, USA). The expression of EF1 and SEC3 was used as reference for calculating the relative amount of target gene expression using the 2−ΔΔCT method [108 (link),109 (link)]. qPCR analysis was based on at least five biological replicates for each sample with three technical replicates.
6
Isolation and Sequencing of RNA from Microtissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To isolate RNA from MTs, tissue samples were collected after 15 days of incubation; at this time, MTs initiate to develop [10 (link)].
Total RNA was isolated by using Trizol (Invitrogen, Carlsbad, CA, USA), RNA concentration was measured by its absorbance at 260 nm, ratio 260 nm/280 nm was assessed, and its integrity confirmed by electrophoresis in agarose 1% (w/v) gels.
Samples of cDNA were amplified by PCR using SYBRTM Green (ThermoFisher CAT: 4312704, Waltham, MA, USA) in Real-Time PCR Systems (CFX96 BioRad, Herules, CA, USA).
Final product cDNA samples for sequencing were sent to GENEWIZ, Plainfield, NJ, USA. Illumina HiSeq 2500 (Illumina, San Diego, CA, USA) was used for sequencing. Sequenced reads were tested for quality using the FastQC software package (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ ) and preprocessed to remove sequence adapters and low-quality bases using the software Trimmomatics [100 (link)].
Total RNA was isolated by using Trizol (Invitrogen, Carlsbad, CA, USA), RNA concentration was measured by its absorbance at 260 nm, ratio 260 nm/280 nm was assessed, and its integrity confirmed by electrophoresis in agarose 1% (w/v) gels.
Samples of cDNA were amplified by PCR using SYBRTM Green (ThermoFisher CAT: 4312704, Waltham, MA, USA) in Real-Time PCR Systems (CFX96 BioRad, Herules, CA, USA).
Final product cDNA samples for sequencing were sent to GENEWIZ, Plainfield, NJ, USA. Illumina HiSeq 2500 (Illumina, San Diego, CA, USA) was used for sequencing. Sequenced reads were tested for quality using the FastQC software package (
7
Plasmid-Peptide Conjugation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid pEGFP-N1 (Clontech, Palo Alto, CA, USA) was purified using QIAGEN Plasmid Mega Kit (Qiagen GmbH, Hilden, Germany). Cysteine terminated CDX peptide was purchased from Biomatic Co. (Wilmington, USA) with a purity percentage of 99%. Bifunctional PEG (NHS-PEG-MAL, MW 2000) was purchased from Nanocs Inc. (Boston, USA). Fluorescein was purchased from Molecular Probes (Eugene, Oregon, United States). The drug Fingolimod was purchased from (AdooQ Bioscience, Centerstone Plaza, Irvine, USA). Other purchased materials were as follows: CS (Chitolytic, 17 Carlaw Ave, Toronto, ON M4M 2R7, Canada), Acetic acid (Sigma–Aldrich, St. Louis, Missouri, USA), cell culture flasks and plates (SPL, Geumgang-ro, Pocheon-si, Gyeonggi-do, Korea), tripolyphosphate (TPP) (Sigma–Aldrich, St. Louis, Missouri, USA), cellulose dialysis bag (cut off 12-14 kDa) (Sigma–Aldrich, St. Louis, Missouri, USA), agarose powder (Bio-Rad, Hercules, California, USA), SYBRTM Green (Thermo Fisher, Waltham, Massachusetts, USA), TNBSA assay (Thermo Fisher, Waltham, Massachusetts, USA), Ellman reagent (Thermo Fisher, Waltham, Massachusetts, USA), DMEM/HG cell medium (Sigma–Aldrich, St. Louis, Missouri, USA), fetal bovine serum (GibcoTM, Thermo Fisher, Waltham, Massachusetts, USA), Pen-Strep, and Trypsin-EDTA (Sigma–Aldrich, St. Louis, Missouri, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!