Pgfp 5 rs plasmids

Manufactured by OriGene

The PGFP-V-RS plasmids are a set of vectors designed for the expression of proteins fused with the green fluorescent protein (GFP) in mammalian cells. These plasmids contain the necessary genetic elements for efficient protein expression and fluorescent tagging.

Automatically generated - may contain errors

Lab products found in correlation

Egfp stat1, by Addgene (1 mentions)

Close spelling variants of this product

PGFP-V-RS

2 protocols using pgfp 5 rs plasmids

Plasmid-based DLX4 overexpression and knockdown

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pIRES-EGFP2 plasmid encoding FLAG-tagged DLX4 has been previously described [25 (link)]. The DLX4 cDNA was subcloned into the pRetroQ-AcGFP retroviral vector (Clontech). Other plasmids were as follows: pGFP-V-RS plasmids containing non-targeting and DLX4 shRNAs (OriGene Technologies), pGIPZ plasmids containing NOS2 shRNAs (GE Healthcare), eGFP-STAT1 (provided by Alan Perantoni, National Cancer Institute, Frederick, MD; Addgene plasmid 12301) [48 (link)], pRc/CMV-Flag STAT1α Y701F [28 (link)] (provided by James Darnell, Rockefeller University, New York, NY; Addgene plasmid 8702). A firefly luciferase reporter construct driven by tandem GAS elements was purchased from SABiosciences.

Trinh B., Ko S.Y., Haria D., Barengo N, & Naora H. (2015). The homeoprotein DLX4 controls inducible nitric oxide synthase-mediated angiogenesis in ovarian cancer. Molecular Cancer, 14, 97.

+ Open protocol

+ Expand

Construction of shScrambled and shIGF1R Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

The shScrambled and shIGF1R plasmids were constructed by inserting double stranded oligos into pGFP-V-RS plasmids (OriGene, Rockville, MD). Oligos were purchased from IDT (Coralville, Iowa). The oligo sequences were taken from the RNAi consortium(The Broad Institute, Cambridge, MA; IGF1R: 5′-GCTGT ACGTCTTCCATAGAAACTCGAGTTTCTATGGAAGA CGTACAGCTTTTT-3′, GFP: 5′-GACCACCCTGACCT ACGGCGTCTCGAGACGCCGTAGGTCAGGGTGGT CTTTTT-3′).

Ungerleider N., Han C., Zhang J., Yao L, & Wu T. (2016). TGFβ Signaling Confers Sorafenib Resistance via Induction of Multiple RTKs in Hepatocellular Carcinoma Cells. Molecular carcinogenesis, 56(4), 1302-1311.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!