For RT-qPCR analysis of miR-146a-5p, miRNA was reversely transcribed to cDNA using a One Step miR cDNA Synthesis Kit (HaiGene, China) based on the manufacturer’s instructions. After reverse transcription, miR-146a-5p expression levels were evaluated using the SYBR® Premix Ex TaqTM II kit (Takara, Japan) on an ABI 7500 RT-PCR instrument (Applied Biosystems, USA) with the following program: 95°C for 2 min, 40 cycles of 95°C for 15 sec, and 60°C for 30 sec. For determination of the expression of mRNA, total larger RNA was reversely transcribed using a ReverTra Ace qPCR RT Kit (Takara, Japan), and then evaluated using the SYBR® Premix Ex TaqTM II kit (Takara, Japan). U6 small nuclear RNA and GAPDH were used as the internal controls of the RT-qPCR of miRNAs and mRNAs, respectively. Primer sequences are listed in Table S1. The relative expression was calculated using ΔCt (target gene Ct – internal control gene Ct) or 2−ΔΔCt.
Sybr premix ex taqtm 2 kit
Manufactured by Takara Bio
Sourced in Japan, China, United States, Germany, Switzerland
The SYBR® Premix Ex TaqTM II kit is a ready-to-use solution for real-time PCR amplification and detection. It contains SYBR® Green I, Taq DNA polymerase, and other necessary reagents for efficient and sensitive PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (107 mentions)
Primescript rt reagent kit, by Takara Bio (59 mentions)
Trizol, by Thermo Fisher Scientific (37 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (24 mentions)
Primescript rt kit, by Takara Bio (24 mentions)
Reverse transcription kit, by Takara Bio (23 mentions)
Primescript rt master mix, by Takara Bio (16 mentions)
Rnaiso plus, by Takara Bio (15 mentions)
Trizol reagent, by Takara Bio (13 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (12 mentions)
Trizol kit, by Thermo Fisher Scientific (10 mentions)
Rneasy mini kit, by Qiagen (10 mentions)
Primescript rt master mix kit, by Takara Bio (10 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (7 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (7 mentions)
Abi 7500 instrument, by Thermo Fisher Scientific (7 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (7 mentions)
Rnaiso plus reagent, by Takara Bio (6 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Easyscript first strand cdna synthesis supermix, by Transgene (6 mentions)
386 protocols using sybr premix ex taqtm 2 kit
1
RT-qPCR Analysis of miR-146a-5p and mRNA
2
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (Invitrogen, Carslbad, CA) reagent was used to extract total RNA from CDs according to the manufacturer’s protocol. RT-qPCR was performed by using the SYBR Premix Ex TaqTMII kit (Takara, Tokyo, Japan). TRT-qPCR was performed with a program of 5 min at 95 °C and then 45 cycles at 95 °C (30 s), 95 °C (5 s), 55 °C (30 s), and 72 °C (30 s). The cycle threshold (CT) values of the samples were analyzed using Thermo Scientific PikoReal software 2.1 (Thermo Fisher Scientific, Waltham, MA, USA). The 2-ΔΔCT method (ΔΔCT = ΔCTtreatment- ΔCTcontrol and ΔCT = Ct target - Ct reference.) was used to calculate the relative expression. Each candidate gene was internally normalized against β-actin.
3
Gene Expression Analysis in Ovarian Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol kits (Invitrogen) were used to extract the total RNA from human OC cell lines, the RNA reverse transcription with RT MasterMix PrimeScriptTM kit for cDNA (TaKaRa, Dalian, China). qRT-PCR was proceeded with SYBR Premix Ex TaqTM II kit (TaKaRa) using cDNA as a template according to the manufacturer’s instruction, GAPDH was used as the internal control. Relative quantitative method was used to determine the results and 2−△△Ct was calculated. The experiment was repeated for three times. The primer sequences used in this study were as follows: PCNA forward primers 5′-GCCTGACAAATGCTTGCT-3′, reverse primers 5′-GCGGGAAGGAGGAAAG-3′; caspase-3 forward primers 5′-CAGTGATGCTGTGCTATGAAT-3′, reverse primers 5′-CAGATGCCTAAGTTCTTCCAC-3′; Twist forward primers 5′-AGCCTGAGCAACAGCGA-3′, reverse primers 5′-ACAGCCCGCAGACTTCTT-3′; MMP-2 forward primers 5′-CGCCTTTAACTGGAGCAAA-3′, reverse primers 5′-AGGTTATCGGGGATGGC-3′; MMP-9 forward primers 5′-ACGCAGACATCGTCATCC-3′, reverse primers 5′-CCAGGGACCACAACTCG-3′; GAPDH forward primers 5′-CCTTCCGTGTCCCCACT-3′, forward primers 5′-GCCTGCTTCACCACCTTC-3′. GAPDH served as the internal control. All experiments were repeated 3 times.
4
Quantitative Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression levels were determined by quantitative real-time PCR using the SYBR Premix Ex TaqTM II Kit (Takara, China) on the LightCycler 480 Real-Time PCR System (Roche). Specific primers were designed using Lasergene sequence analysis software (DNAStar, Inc., Madison, WI, USA) based on GenBank sequences (Table 1 ). Amplification was performed in 20 μl reactions containing 1 μl of cDNA and 0.8 μl of each specific primer. The following amplification conditions were used: initial denaturation at 95°C for 30 s, followed by 40 cycles at 95°C for 10 s and annealing and extension at 55°C for 45 s. Melting curves were obtained, and the relative gene expression levels were measured using the 2−ΔΔCt method. Mock-infected cells were introduced as control (relative expression =1). Experiments were performed in triplicate.
5
Quantifying Gene Expression in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from CRC tissue specimens and four CRC cell lines with TRIZOL reagent, as described by the manufacturer. The A260/A280 ratios of all RNA samples ranged from 1.8t to 2.0. cDNA was synthesized from approximately 500–1,000 ng of total RNA using the High Capacity cDNA Reverse Transcriptase Kit (Takara Bio, Japan). The cDNA synthesis reaction was performed using a MyCycler Thermal Cycler (Bio-Rad) using the following conditions: 25°C, 10 minutes; 37°C, 120 minutes; 85°C, 5 minutes; 4°C, hold. cDNA samples were diluted 1:4 using nuclease-free water. Two microliters of cDNA were used as a template for qPCR. After reaction assembly, the plate was centrifuged briefly. Samples were performed in duplicate. Reaction mixtures were prepared as follows: 94°C for 40 seconds and 45 cycles of 94°C for 5 seconds and 58°C for 30 seconds, and were analyzed in a Light Cycler 2.0 with SYBR Premix Ex TaqTM II kit (Takara Bio). The primer sequences: RNF126, 5ʹ- CCCACGCTGGAAGGGATCAT G‐3ʹ and 5ʹ- CCTACGTGCTCCTCAGTGAC-3ʹ; p53, 5ʹ- AGAGCTGAATGAGGCCTTGGAA-3ʹ and 5ʹ- GAGTCAGGCCCTTCTGTCTTGAAC-3ʹ; p21, 5ʹ- AGGTGGACCTGGAGACTCTCAG-3ʹ and 5ʹ-TCCTCTTGGAGAAGATCAGCCG-3ʹ. GADPH, 5ʹ- TGACTTCAACAGCGACACCCA −3ʹ and 5ʹ - CACCCTGTTGCTGTAGCCAAA −3ʹ. Quality control of the PCR products was monitored with melt-curve analysis. The results were calculated using the -ΔΔCt method.
6
Quantifying Parasite Burden via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the peritoneal fluid of parasite-infected mice using the Steady Pure Genomic DNA Kit (AG Biotech, Hunan, China). Parasite burden was determined by qPCR amplification of the Tg-529 gene (forward primer 5’- CGCTGCAGGGAGGAAGACGAAAGTTG-3’ and reverse primer 5’- CGCTGCAGACAGAGTGCATCTGGATT-3’) using corresponding genomic DNA samples. The values were normalized to the number of mouse-actin genes (forward primer 5’-AGCTTCTTTGCAGCTCCTTCGT-3’ and reverse primer 5’- TACACGCTAGGCGTAAAGTTGG-3’) in each sample. Real-time qPCR was carried out with the SYBR® Premix Ex TaqTM II Kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions, and reactions were run on the Roche LC480II system. A standard curve was obtained for the quantification of parasites. Genomic DNA from 0, 100, 101, 102, 103, 104, 105, 106 and 107 parasites were extracted. The CT value of each sample was then obtained using Tg529-based qPCR as the ordinate and Lg (tachyzoite number) as the abscissa. Subsequently, a standard curve was generated from the CT values and Lg, and the parasite burden was calculated from the standard.
7
Quantitative Analysis of Circadian Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the GC tissues and cells by TRIzol reagent (Invitrogen). The RNA was reversely transcribed into cDNA by a PrimeScriptTM RT reagent Kit (TaKaRa, Dalian, China). qRT-PCR was performed with an SYBR® Premix Ex TaqTM II Kit (TaKaRa) in ABI7500 System (Applied Biosystems, Foster City, CA, USA), with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) and U6 as the internal references. The 2−ΔΔCt method was used to quantify the relative expression of each target gene. Primer sequences are listed in Table 1 .Table 1
Sequences used for qRT-PCR.
| circ_0075825 | Forward: 5′-GGATGGCTGTTCTCCATTGT-3′ |
| Reverse: 5′-TATACATGCACGCCCTCAAA-3′ | |
| miR-432-5p | Forward:5′-AACGAGACGACGACAGAC-3′ |
| Reverse:5′-CTTGGAGTAGGTCATTGGGT-3′ | |
| U6 | Forward:5′-AACGAGACGACGACAGAC-3′ |
| Reverse:5′-GCAAATTCGTGAAGCGTTCCATA-3′ | |
| SOX9 | Forward: 5′-CAAGAAGGACCACCCGGATT-3′ |
| Reverse: 5′-AAGATGGCGTTGGGGGAGAT-3′ | |
| CTNNB1 | Forward: 5′-AAAGCGGCTGTTAGTCACTGG-3′ |
| Reverse: 5′-CGAGTCATTGCATACTGTCCAT-3′ | |
| COL10A1 | Forward: 5′-ATGCTGCCACAAATACCCTTT-3′ |
| Reverse: 5′-GGTAGTGGGCCTTTTATGCCT-3′ | |
| GAPDH | Forward:5′-GACTCATGACCACAGTCCATGC-3′ |
| Reverse:5′-AGAGGCAGGGATGATGTTCTG-3′ |
8
Quantifying EPC Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from EPCs was extracted using TRIzol reagent (ThermoFisher, #15596018) according to the manufacturer's instructions. mRNA was reverse transcribed according to the manufacturer's instructions using a reverse transcription kit (Takara, RR036A). PCR was carried out according to the manufacturer's instructions using a SYBR® Premix Ex TaqTM II Kit (Takara, RR420A). The relative expression value of a target gene was calculated according to the 2−ΔΔCt method. The primer sequences were as follows: SDF-1: forward primer, 5′-ATTCTCAACACTCCAAACTGTGC-3′, reverse primer, 5′- ATTCTCAACACTCCAAACTGTGC-3′; and VEGF: forward primer, 5′- GAGGAGCAGTTACGGTCTGTG-3′, reverse primer, 5′-TCCTTTCCTTAGCTGACACTTGT-3′.
9
TET2 mRNA Expression Influenced by rs3733609
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess whether TET2 mRNA expression was influenced by rs3733609 SNP, real-time quantitative PCR was performed for evaluating the expressions of TET2 mRNA. 35 of MPN with rs3733609 T/T genotype and 18 of MPN with rs3733609 C/T genetype were compared for TET2 mRNA expressive abundance. In brief, bone marrow (5 mL) mononuclear cells (BMMNCs) were isolated by Ficoll centrifugation; total cellular RNA from 1 × 106 cells/mL was extracted by Trizol reagents (Invitrogen). Random primers and M-MLV reverse transcriptase (TaKaRa) were used to generate cDNA. Real-time quantitative PCR was carried out on a LightCycler 96 (Roche, Switzerland) using SYBR® Premix Ex Taq TM II Kit (TaKaRa). Primers sequences were as follows: Human TET2-specific primers: forward primer: 5′-CTATTGCTAAGTGGGTGGTTCG-3′; reverse primer: 5′-GCCGTATTTCCTCAGCGTCTC -3′. Human β-actin amplifation was designed as internal control. The PCR reactive system comprised cDNA template 2 uL, 2xSYBR mix 10 uL, forward or reverse primers 10 uM.
10
Liver and White Adipose Tissue Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver and WAT samples using Trizol reagent (Invitrogen, USA) and quantified using Bio-Nano and agarose gel electrophoresis. Complementary DNA (cDNA) was reverse transcribed from 1 μg RNA using PrimeScriptTM RT reagent kit (TaKaRa, Japan). RT-PCR detection of gene expression was performed using a SYBR Premix Ex TaqTM II kit (TaKaRa, Japan) on the LightCycler 480 II system of the fluorescent quantitative PCR (Roche, Switzerland). The thermocycler conditions were: initial denaturation at 95 °C for 30 s, 40 cycles of 95 °C for 10 s, and 58 °C for 1 min. The sequences of the primers (Supplementary Table S3 ) were synthesized by BGI (Shenzhen, China). The expression of each gene was normalized to the reference gene, β-actin, and expressed relative to the control group according to the 2−ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!