Navios cytometer

Intracellular staining of Ki-67 was performed using a fluorescein isothiocyanate (FITC)-labeled antibody against Ki-67 (Becton Dickinson, Franklin Lakes, NJ, USA) after fixation and permeabilization using the BD Intrasure kit (Becton Dickinson) following the manufacturer's instructions. Surface staining of cells was performed using the following monoclonal antibodies conjugated with the indicated fluorochrome: CD19-phycoerythrin (PE) and CD5-allophycocyanine (APC) (Becton Dickinson). To characterize the phenotype of proliferative and resting compartments of CLL cells,we used the following antibodies: CD19-energy coupled dye (ECD), CD5-phycoerythrincyanine 5.5 (PC5.5) (Beckman Coulter, Brea, CA, USA), CD3-PE-cyanine 7 (Cy7), CXCR4-APC, CXCR5-APC, CCR7-APC, CD49d-APC, CD62L-APC, Ki-67-FITC (Becton Dickinson), and CD38-PE (EBioscience, San Diego, CA, USA). The rates of T cell activation and proliferation were analyzed by determining the expression of Ki-67, CD69 and CD38 in CD3+ cellsusing the following antibodies: Ki-67-FITC, CD38-PE (EBioscience), CD5-PC5.5 (Beckman Coulter), CD3-PE-Cy7 and CD69-APC (Becton Dickinson). Cells were acquired in a Navios^TM cytometer (Beckman Coulter) and the results were analyzed using the FCS Express 4 software (De Novo Software, Los Angeles, CA, USA).

For staining, 2 × 10⁵ cells/well were centrifuged in V-bottom 96-well plates and washed with phosphate-buffered saline (PBS, Lonza) containing 0.5% bovine serum albumin (Lonza), 1% FBS and 0.1% sodium azide. Non-specific binding was blocked by pre-incubating the cells with 40 μg/ml rat IgG (Sigma; 100 μl final volume, 20 min, 4°C). Cells were incubated with anti CXCR4-APC mAb (BD Pharmingen; clone 12G5) or isotype matched mAb (30 min, 4°C). Samples were analyzed on a Navios cytometer (Beckman Coulter).
For qRT-PCR, cell culture RNA was obtained using RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. The relative expression level of mRNA encoding human CXCR4 was determined by quantitative RT-PCR using GUS gene expression as internal control. cDNA was synthesized from 1 μg of total RNA with the Superscript IV First-Strand Synthesis System (Invitrogen). The cDNA was amplified in duplicate with primers for human CXCR4 (Hs00237052_m1, Applied Biosystems) and for human GUS (Fw: 5′-GAAAATATGTGGTTGGAGAGCTCATT−3′, Rv: 5′-CCGAGTGAAGATCCCCTTTTTA−3′; Probe: 5′-[6FAM] CCAGCACTCTCGTCGGTGACTGTTCA[TAMRA]−3′; all from Sigma). Amplification (1 cycle: 50°C for 2 min, 95°C for 10 min; 50 cycles: 95°C for 15 s, 60°C for 1 min) was monitored using the Roche LightCycler 480. Relative expression was analyzed using 2^−ΔCT method, where ΔCT = (Ct gene of interest- Ct internal control).

Five milliliters of venous peripheral blood from patients and healthy volunteers was collected in EDTA-coated tubes. Samples of 50 μL blood per tube were transferred for staining with monoclonal antibodies and red blood cell (RBC) lysis. Peripheral blood samples were stained according to the manufacturer's recommendations using the following fluorochrome-coupled antibodies: anti-CD14-FITC (IM0645U, Beckman Coulter Company), anti-HLA-DR-PB (A74781, Beckman Coulter Company), and anti-CD45-KO (A96416, Beckman Coulter Company). Whole blood cells were incubated with antibodies against surface markers at room temperature (approximate range 20°C to 25°C) for 15 min in the dark. After RBC lysis washing, cells were collected and analyzed with Navios Cytometer (Beckman Coulter Company). Mo-MDSCs were defined as CD45⁺, CD14⁺, and HLA-DR^low/−. Isotype-matched antibodies were used in all samples as controls. Specifically, the population defined as HLA-DR^low/− was based on isotype staining with gating to include, at a minimum, 95% of the CD14⁺ population.

IL-2, IL-4, IL-6, IL-10, IL-17A, TNF-α, and IFN-γ were quantified in sera from healthy controls and subjects with psoriasis by Th1/Th2/Th17 cytokine assay (JiangXi Cellgene Biotech Co., LTD, China) according to the manufacturers' instructions. Data were acquired using a Navios Cytometer (Beckman Coulter Company). Standard curves were constructed, and calculations were performed using JiangXi Cellgene Biotech Co., LTD CBA software.
Arg-1 was quantified in sera from healthy controls and subjects with psoriasis by a quantitative colorimetric arginase determination assay (Quanti Chrom Arginase Assay Kit, DARG-200, Bioassay Systems) according to the manufacturer's instructions.
NO was quantified in sera from healthy controls and subjects with psoriasis using the NO kit (Moledia Technology Corp. of Beijing) and AU5822 (Beckman Coulter), according to the manufacturer's instructions. Serum iNOS level was quantified using iNOS Detection kits (A014-1, Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's instructions.

Total PBMCs were stimulated with 1 μg/mL phorbol 12-myristate 13- acetate (PMA) (Sigma-Aldrich) and 0.5 μg/mL ionomycin (Sigma-Aldrich) for 4 hours in the presence of 1 μl/mL GolgiPlug (BD) in RPMI 1640 medium supplemented with 5% of serum blood type AB, 2 mmol/L L-glutamine, 100 U/mg/mL penicillin/streptomycin, and at 5x10⁴ cells/well. After cell surface staining, intracellular staining with IFN-gamma, TNF-alpha, IL-10 and IL-4 was performed using the Cytofix/Cytoperm kit (BD). Cells were acquired on Navios Cytometer (Beckman Coulter) and analyzed with Kaluza software (Beckman Coulter).

Peripheral blood was obtained before (range 5 to 12 weeks) and after (at month 1, 2, 3, 5–7, and 12–14) aHSCT. Distribution of B cell subsets was obtained from fresh blood via immunophenotyping. Staining was performed with the Navios cytometer (Beckman Coulter, Krefeld, Germany) using the following antibodies: CD19-phycoerythrin-cyanin (PC) 7, CD20-allophycocyanin (APC) 750, CD45-Krome Orange, CD27-phycoerythrin-Texas Red-X (ECD), CD38-PC5.5 (each Beckman Coulter, Krefeld, Germany), IgD-fluorescein isothiocyanate (FITC), CD10-phycoerythrin (PE) (each BD Biosciences, San Jose, CA), CD21-Pacific Blue (Exbio, Prague, Czech Republic), and IgM-APC (BioLegend, San Diego, CA). Lymphocytes were identified by using forward versus sideward scatter. Within the lymphocyte gate, at least 3000 events were collected and CD19⁺ cells were identified as B cells. Transitional B cells were defined as CD38⁺⁺/CD10⁺/IgD⁺, pre-switched memory B cells as CD27⁺/IgD⁺, post-switched memory B cells as CD27⁺/IgD⁻, double-negative B cells as CD27⁻/IgD⁻, naïve B cells as CD27^-/IgD⁺, and circulating plasmablasts as CD38⁺⁺/CD27⁺⁺/IgD⁻.

One peripheral blood EDTA tube was drawn per patient (n=70) prior to ICI therapy initiation, at an early (after one to two cycles, n=51) and late time-point (after three to five cycles, n=47) during therapy. Freshly isolated cells were lysed using the Immunoprep Reagent System (Beckman Coulter) and staining was performed with two different flow cytometry panels. Panel 1 was stained with the antibody mix CD45-FITC/CD56-PE/CD19-ECD/CD3-PC5, to which the antibody CD-16 PE was added, and panel 2 was stained with the antibody mix CD45-FITC/CD4-PE/CD8-ECD/CD3-PC5, to which the antibody HLA-DR-PC7 was added (all antibodies from Beckman Coulter, Krefeld, Germany), according to manufacturer´s instructions. Flow-cytometry analysis was carried out and analyzed using NAVIOS cytometer and analysis software (Beckman Coulter). These analyses were performed within the clinical routine diagnostics of immune status by the hematological laboratory of the department of medicine IV of the University Medical Center Aachen, which includes standardized gating strategy to distinguish B cells (CD19+), NK cells (CD3-CD56+CD16+), and T cell subsets (CD3+CD4+, CD3+CD8+, CD3+CD56+CD16+, CD3+HLA-DR+) (Supplementary Figures 1A–D).