Rnaisoplus assay kit

Total RNA of cells administered different treatments was extracted using the RNAiso Plus assay kit (Trizol, Takara Biomedical Technology Co. Ltd., Beijing, China) following the manufacturer’s instructions. The quality and concentration of total RNA were assessed using a microplate reader (OD260/OD280) and 1% agarose gel electrophoresis. The isolated RNA was reverse transcribed into cDNA using the PrimeScriptTM II 1st Strand cDNA Synthesis kit (TaKaRa). The temperature protocol used for reverse transcription was 37°C for 60 min, and 85°C for 5 s. The sequences of all primers are displayed in Table 1, and qPCR was performed using SYBR Premix EX Taq (2x, Thermo Fisher Scientific, USA). The following cycling program was used for qPCR: 50°C for 3 min, 95°C for 3 min, followed by 40 cycles of 95°C for 10s and 60°C for 30s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the housekeeping gene, and the relative mRNA levels of RUNX2, p38 MAP kinase (p38MAPK), microtubule-associated protein 1 light chain 3 alpha (LC3-II), COL1A1, heat shock 90-like protein (p62), alkaline phosphatase (ALP), Beclin-1, Sp7 transcription factor (OSX), and bone gamma-carboxyglutamate protein (OCN) were calculated using the 2^−ΔΔCt method [19 (link)].

The total RNA content in cultured cell samples and collected tissue samples was extracted by utilizing an RNA ISO Plus assay kit (Takara) in accordance with the instructions provided by the manufacturer. In the next step, the extracted total RNA was reversely transcribed to cDNA by utilizing an Omniscript RNA Reverse Transcription Assay Kit (Qiagen). Then, the obtained cDNA was subjected to real‐time polymerase chain reaction (PCR) carried out on a 7500 real‐time PCR instrument (Applied Biosystems) in conjunction with a SYBR Green Master Mix (Thermo Fisher Scientific) in accordance with the instructions provided by the manufacturer. Finally, the relative expression of P‐gp mRNA was calculated based on the threshold value of the real‐time PCR amplification of P‐gp and normalized to the expression of housekeeping gene GAPDH. The forward and reverse primers for P‐gp mRNA was 5′‐GCTGTCAAGGAAGCCAATGCCT‐3′ and 5′‐TGCAATGGCGATCCTCTGCTTC‐3′. And the forward and reverse primers for GAPDH was 5′‐GTCTCCTCTGACTTCAACAGCG‐3′ and 5′‐ACCACCCTGTTGCTGTAGCCAA‐3′.