Cadherin 11

Manufactured by Thermo Fisher Scientific

Sourced in United States

Cadherin-11 is a cell-cell adhesion protein that plays a role in cell-cell interactions and tissue organization. It functions by forming calcium-dependent homophilic adhesions between cells. Cadherin-11 is expressed in various tissues, including the brain, heart, and cartilage.

Automatically generated - may contain errors

Lab products found in correlation

Hrp conjugated rabbit anti mouse igg, by Abcam (1 mentions) Chemidoc touch imaging system, by Bio-Rad (1 mentions) Pvdf membrane, by Bio-Rad (1 mentions) Gapdh, by Abcam (1 mentions) Rankl, by Abcam (1 mentions) Phosphorylated akt, by Abcam (1 mentions) Rabbit anti mouse igg, by Abcam (1 mentions) Phosphorylated creb, by Abcam (1 mentions) Phosphorylated pi3k, by Abcam (1 mentions) Cxcl10, by R&D Systems (1 mentions) Goat anti mouse igg, by Abcam (1 mentions) α tubulin, by Merck Group (1 mentions) Collagen type 1 from rat tail, by Merck Group (1 mentions) Phalloidin tetramethylrhodamine isothiocyanate, by Merck Group (1 mentions) Horseradish peroxidase conjugated secondary antibody, by Agilent Technologies (1 mentions) α actinin, by Merck Group (1 mentions) Enhanced chemiluminescence, by GE Healthcare (1 mentions) Glyceraldehyde 3 phosphate dehydrogenase gapdh, by Merck Group (1 mentions) E cadherin, by BD (1 mentions) N cadherin, by BD (1 mentions)

Spelling variants of this product

Anti-cadherin-11 (2 citations)

7 protocols using cadherin 11

Western Blot Analysis of Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteins (20 μg) were separated on SDS-PAGE gels. Then, the proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad Laboratories). The PVDF membranes were then blocked with 5% BSA diluted in TBS for 1 h at room temperature. Primary antibodies against CXCL10 (R&D), RANKL (Abcam), Cadherin-11 (Invitrogen), mTOR (Abcam), phosphorylated mTOR (Abcam), CREB (Abcam), phosphorylated CREB (Abcam), AKT (Abcam), phosphorylated AKT (Abcam), PI3K (Abcam), phosphorylated PI3K (Abcam) and GAPDH (Abcam) were then added according to the manufacturers’ protocols. The samples were agitated at 4 °C overnight. HRP-conjugated rabbit anti-mouse IgG (Abcam), mouse anti-rabbit IgG (Abcam) and goat anti-mouse IgG (Abcam) secondary antibodies were added and incubated at room temperature for 2 h. Densitometric analysis was performed using the ChemiDoc Touch Imaging System (Bio-Rad Laboratories).

Qian J., Gong Z.C., Zhang Y.N., Wu H.H., Zhao J., Wang L.T., Ye L.J., Liu D., Wang W., Kang X., Sheng J., Xu W., Liu X.L., Wu J, & Zheng W. (2021). Lactic acid promotes metastatic niche formation in bone metastasis of colorectal cancer. Cell Communication and Signaling : CCS, 19, 9.

+ Open protocol

+ Expand

Antibody-based Protein Detection Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies used were goat anti-GST antibody (GE Healthcare, Piscataway, NJ), palladin (reacts with the 90-, 140-, and 200-kDa isoforms), or a 4Ig isoform-selective palladin (reacts with the 140- and 200-kDa isoforms; Ronty et al., 2006 (link)), HA and MT1-MMP rabbit polyclonal antibodies (Abcam, Cambridge, United Kingdom), and mouse monoclonal antibodies against MT1-MMP (antibody against the catalytic domain recognizing both the latent and active protease), cortactin, phospho-tyrosine (EMD Millipore Corporation, Temecula, CA), HA (Cell Signaling Technology, Danvers, MA), α-actinin, α-tubulin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Sigma-Aldrich, St. Louis, MO), phospho-FAK, E-cadherin, N-cadherin (BD Transduction Laboratories, Franklin Lakes, NJ), vimentin (Santa Cruz Biotechnology, Dallas, TX), and cadherin 11 (Invitrogen), as well as Alexa Fluor 647–phalloidin secondary antibodies (Invitrogen), and horseradish peroxidase–conjugated secondary antibodies (Dako, Agilent Technologies, Santa Clara, CA). We also used GM6001, and PP2 inhibitors (Millipore), PDGF-AB (R&D Systems, Minneapolis, MN), enhanced chemiluminescence (GE Healthcare), phalloidin–tetramethylrhodamine isothiocyanate, and collagen type I from rat tail (Sigma-Aldrich).

von Nandelstadh P., Gucciardo E., Lohi J., Li R., Sugiyama N., Carpen O, & Lehti K. (2014). Actin-associated protein palladin promotes tumor cell invasion by linking extracellular matrix degradation to cell cytoskeleton. Molecular Biology of the Cell, 25(17), 2556-2570.

+ Open protocol

+ Expand

Western Blot Analysis of Key Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blot analysis was performed as described previously [44 (link)]. Cultured cells were lysed in SDS gel loading buffer or RIPA buffer with protease inhibitor cocktail (Roche Life Science, Indianapolis, IN) and phosphate inhibitor cocktail (Thermo Scientific, Rockford, IL), equal amount of proteins were loaded on 4-12% or 4-20% SDS-PAGE gels (Invitrogen). After electrophoresis, proteins were transferred to a nitrocellulose membrane and probed with primary antibodies of Ezrin, β-Actin (Sigma, St. Louis, MO), TDAG51 (Santa Cruz Biotechnology, Inc. Dallas, Texas), VEGFA (Proteintech Group, Inc., Chicago, IL), VEGFR2 (Cell Signaling Technology, Inc. Boston, MA), Cadherin11 (Invitrogen), Heparanase1, Vimentin (Abcam, Cambridge, MA), S100A6 (Gift from Dr. Mark Simpson's lab, NCI/NIH), MMP9 (Proteintech).

Ren L., Mendoza A., Zhu J., Briggs J.W., Halsey C., Hong E.S., Burkett S.S., Morrow J.J., Lizardo M.M., Osborne T., Li S.Q., Luu H.H., Meltzer P, & Khanna C. (2015). Characterization of the metastatic phenotype of a panel of established osteosarcoma cells. Oncotarget, 6(30), 29469-29481.

+ Open protocol

+ Expand

Monoclonal Antibodies for p140Cap and Synaptic Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Specific mouse monoclonal antibody (Mab) against p140Cap (clone 2A8) was produced at the MBC, University of Torino, as previously described (Di Stefano et al., 2007 (link); Repetto et al., 2013 (link)). The antibodies used are as follows: Dlg4 (Mab, Abcam), Citron-N (rabbit polyclonal, Abcam), Grin2A (rMab from Millipore; rabbit polyclonal from Thermo Scientific), Grin2b (mouse monoclonal antibody, Neuromab), Grin1 rabbit polyclonal (Thermo Scientific), Shank2 (rabbit polyclonal, Synaptic System), Shank3 (rabbit polyclonal, Synaptic System), Snap25 (Mab, Synaptic System), Actin I-19 (rabbit polyclonal, Santa Cruz Biotechnology), Trio (rabbit polyclonal, Santa Cruz Biotechnology), rabbit polyclonal Camk2 (Cell Signaling), Homer-1 (rabbit polyclonal, Thermo Scientific), Cadherin-11 (Mab, Thermo Scientific), Syncam (rabbit polyclonal, Thermo Scientific), Ttc3 (rabbit polyclonal, as described in Berto et al., 2007 (link)), and Gfap (Mab, Dako-Agilent Technologies), Bassoon (rabbit polyclonal, Synaptic System). Mouse and rabbit IgGs were purchased from Santa Cruz Biotechnology. Secondary antibodies anti-mouse and anti-rabbit were purchased from Sigma Aldrich.

Alfieri A., Sorokina O., Adrait A., Angelini C., Russo I., Morellato A., Matteoli M., Menna E., Boeri Erba E., McLean C., Armstrong J.D., Ala U., Buxbaum J.D., Brusco A., Couté Y., De Rubeis S., Turco E, & Defilippi P. (2017). Synaptic Interactome Mining Reveals p140Cap as a New Hub for PSD Proteins Involved in Psychiatric and Neurological Disorders. Frontiers in Molecular Neuroscience, 10, 212.

+ Open protocol

+ Expand

Silencing PDGFR and Cadherin-11 in Human Fibroblasts

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pooled siRNA against PDGFRα and PDGFRβ were purchased from Santa Cruz Biotechnology. Control (5’ CAACAAGAUGAAGAGCACCAAUU 3’) and cadherin-11 (5’ CCA CUU UCC AAC CAG CCA AUU UU 3’) were synthesized by Thermo Fisher Scientific; sequences was validated in previous fibroblast studies[13 (link), 38 (link)]. Primary human fibroblasts were transfected overnight with siRNA using the lipid reagent Dharmafect 3, rested for 24 hours and then serum-starved overnight before additional analysis. Silencing efficiency was confirmed by western analysis, flow cytometry staining, or quantitative reverse transcription polymerase chain reaction (qRT-PCR), as indicated. Lentiviral short-hairpin (sh) RNA silencing of cadherin-11 was performed as previously described[13 (link)].

Madarampalli B., Watts G.F., Panipinto P.M., Nguygen H.N., Brenner M.B, & Noss E.H. (2019). Interactions between cadherin-11 and platelet-derived growth factor receptor-alpha signaling link cell adhesion and proliferation. Biochimica et biophysica acta. Molecular basis of disease, 1865(6), 1516-1524.

+ Open protocol

+ Expand

Protein Expression Analysis in Cell Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols

After drug treatment, cells extracts were collected in 2×SDS sample buffer and protein concentrations were determined with Amido Black Protein Assay. Equal amounts of total protein lysate (20 µg) were loaded onto SDS-PAGE gels for separation and transferred to nitrocellulose membrane for immunoblotting. The following primary antibodies were used: ph-NF-κB, IκBα, and cleaved caspase-3 (Cell Signaling Technology, Danvers, MA, USA), β-actin (CoWin Bioscience, Beijing, China), TNFR1 (Abcam, Cambridge, MA, USA), cadherin-11 (Life Technologies, Carlsbad, CA, USA). The appropriate anti-mouse Ig and peroxidase-conjugated anti-rabbit Ig secondary antibodies (CoWin Bioscience, Beijing, China) were used. The signals were detected and quantified using a Fluorchem FC2 Luminescent Imager (Alpha Innotech).

Liu Q.S., Wang H.F., Sun A.K., Huo X.P., Liu J.L., Ma S.H., Peng N, & Hu J. (2014). A Comparative Study on Inhibition of Total Astragalus Saponins and Astragaloside IV on TNFR1-Mediated Signaling Pathways in Arterial Endothelial Cells. PLoS ONE, 9(7), e101504.

+ Open protocol

+ Expand

Protein Interactions via Co-Immunoprecipitation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Co-Immunoprecipitations (Co-IP) were performed using Dynabeads (Life Technologies) according to the manufacturer’s protocol. β-Catenin (BD Biosciences #610153, dilution 1:1000) or Lasp1 antibody (Abcam #ab130109, dilution 1:1000) was coupled to protein G–labelled Dynabeads. Equal amounts of cell lysates were transferred to the antibody-bead complex and incubated overnight at 4 °C. Antibodies against the following proteins were detected by immunoblotting: β-Actin (Abcam #ab8227, dilution 1:1000), β-Catenin (Cell Signaling #9562, dilution 1:1000), Cadherin-11 (Life Technologies #321700, dilution 1:1000), Lasp1 (Abcam #ab130109, dilution 1:2000), p120-Catenin (BD Biosciences #610134, dilution 1:1000) and GAPDH (Cell Signaling #3638 S, dilution 1:1000).

Beckmann D., Römer-Hillmann A., Krause A., Hansen U., Wehmeyer C., Intemann J., de Gorter D.J., Dankbar B., Hillen J., Heitzmann M., Begemann I., Galic M., Weinhage T., Foell D., Ai R., Kremerskothen J., Kiener H.P., Müller S., Kamradt T., Schröder C., Leitão E., Horsthemke B., Rosenstiel P., Nordström K., Gasparoni G., Gasparoni N., Walter J., Li N., Yang X., Chung H.R., Pavenstädt H., Lindemann N., Schnittler H.J., Wang W., Firestein G.S., Pap T, & Korb-Pap A. (2021). Lasp1 regulates adherens junction dynamics and fibroblast transformation in destructive arthritis. Nature Communications, 12, 3624.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!