Cas9 protein

UPEC strain CFT073 (ATCC # 700928; United States), Commensal strain K12 MG1655 (ATCC # 700926; United States), Luria–bertani broth (Himedia cat # M1245; India), Agar (Himedia cat # GRM666; India), C. elegans Bristol wild type N2 strain , E.coli OP50, THP-1 cells (ATCC # TIB-202; United States), RPMI-1640 (Gibco Cat# 11875119; United States), Hela cells (ATCC # CCL2; United States), DMEM (Cat#L0104, Biowest, Nuaille, France), fetal bovine serum (Gibco Cat# 10270106; United States), T24 cells (ATCC# HTB-4™; United States), McCoy’s 5A modified Media(Gibco Cat# 16600082),3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide-MTT (Invitrogen Cat # M6494; United States), cas9 Protein (Invitrogen Cat # A36497; United States), 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) (Himedia Cat# RM1817, India), N-hydroxysulfosuccinimide (Sulfo-NHS) (Himedia Cat# RM1120, India), HEPES buffer solution (Sigma-Aldrich Cat # 83264; United States), GeneArt™ Precision gRNA Synthesis Kit (Invitrogen Cat # A29377, United States), TRI Reagent (Sigma Cat # T9424; United States), RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific Cat # K1622; United States), SYBR Green Master Mix (Appliedbiosystems Cat# A25742; United States), Crystal violet ( SRL Cat# 28376, India) and SYTO9 green fluorescent nucleic acid stain (Invitrogen Cat # S34854, United States) were used.

The protocol to generate mutant locusts using CRISPR/Cas9 system was previously described [7 (link)]. The embryos of locusts were collected from egg pods, washed with 75% ethanol, and were placed on 1% agarose gel. The purified Cas9 protein (Invitrogen, A36496, Massachusetts, USA) and guide RNA were mixed to final concentrations of 400 and 150 ng/μl, respectively (13.8 nL), and were injected in the embryos using a microinjection machine. Then, the embryos were placed in a 30 °C incubator for approximately 14 days until the locusts hatched. The first-instar nymphs were placed in the cages with 14-h-light and sufficient food. We collected part of adult legs and lysed them with a 45 μL NAOH buffer (50 mM) at 95 °C in a PCR machine for 30 min and added 5 μL Tris-HCL (PH = 8.0, 1 M). Then, we used a 2 μL template to amplify the targeted fragments, and we sequenced the fragments to identify whether the mutants were generated. The used primers were designed in introns 3 and 4 of LmigOr35 as follows: LmigOr35 intron 3-For, GTAAGTTCAGCCTGCTGTAT; LmigOr35 intron 4-Rev, and GTTTCAGCTAGTAGTACGAC. A 485 bp product was obtained from the WT locust after PCR reaction.

The odr-3(rms31) mutant was generated by CRISPR using a dual crRNA dpy-10 co-CRISPR strategy and a custom protocol based on previous methods^{52 (link),53 (link)} and optimization for our laboratory. In brief, 1 µl of 320 µM solution of each CRISPR RNA (crRNA) and 0.5 µl of dpy-10 crRNA (50 µM) was annealed to 0.4 µl of 100 µM trans-acting CRISPR RNA (tracrRNA) (Integrated DNA Technologies) by heating to 95 °C in a PCR machine and cooling to 4 °C at 0.1 °C s⁻¹. Then, 0.5 µl of Cas9 protein (Invitrogen) was added, and the mixture was incubated for 10 min at 37 °C. Next, 0.5 µl of 100 µM stock of each repair template (target and dpy-10) was added, and the solution was made up to 20 µl with DPEC water. This mix was centrifuged for 30 min at 20,000g at 4 °C before injection. Oligonucleotides used in this study are provided in Supplementary Tables 3 and 4.

Electroporation of sgPtpn11, tracrRNA (#1075928, IDT) and CAS9 protein (A36498, Invitrogen) into 4T1 cells to establish 4T1-CAS9-sgPtpn11 pool was performed following the manufacturer’s instruction by using SE Cell Line 4D-Nucleofector X Kit S (#V4XC-1032, Lonza) and Nucleofector 4D, X-unit (#AAF-1002X, Lonza). CM-150 electroporation program was used for 4T1 cells. sgControl (#1072544, IDT) was used as negative control. sgPtpn11 target sequence is listed below. Ablation of target gene was validated by western blots (Supplementary Fig. 9a).
sgPtpn11: GCTTGCTTAACTCTCGAACC.

Cells (2 × 10⁵) were washed twice with PBS and nucleofected with 5 μg Cas9 protein (IDT) and 1 μg sgRNA in a total volume of 10 μl ‘buffer R’ using the Neon Transfection System (Invitrogen, cat. #MPK5000).

To establish HLA-I negative iPSCs, we designed CRISPR/Cas9 B2M gene editing experiment to target “GAGTAGCGCGAGCACAGCTA” DNA sequence of human B2M gene. Briefly, 7.5 μg Cas9 protein (Invitrogen, A36498) and 50 pmol B2M sgRNA were mixed to form 12 μL B2M ribonucleoprotein complex (B2M-RNP) and added into 100 μL Nucleofector buffer (Lonza). 4 × 10⁵ C55 iPSCs were transfected with the above B2M-RNP/Nucleofector solution by electroporator 2B Nucleofector with A-023 program. After electroporation, cells were transferred to Matrigel-coated 6-well plates and cultured in BioCISO+Y-27632 medium for 3–5 days. HLA-I expression was detected by staining with anti-HLA-ABC antibodies (Biolegend, 311406). One week later, HLA-ABC negative iPSCs were sorted by FACS AriaII (BD) into Matrigel-coated 24-well plates and grown in BioCISO+Y-27632 medium. Single cell clones of B2M KO iPSCs (C55-B2M^KO) were isolated by limiting dilution cloning (LDC).

To change the ABCC10 rs2125739 SNP from wild type to variant in HeLa cells with the wild type sequence at that location, we purchased custom-designed gRNA (target sequence gRNA1; ACGGATGTCTGAGGAGCCAT, gRNA2; GATGTCTGAGGAGCCATTGG) from ThermoFisher Scientific Life Technologies Japan (Tokyo, Japan). Specifically, HeLa cells were co-transfected with Cas9 protein (Invitrogen, Carlsbad, CA) and Donor DNA (with the “C” allele SNP sequence) according to the instructions included with lipofectamine CRISPRMAX (Invitrogen). After 48 h, the cells were transferred to a 96-well culture plate for clonal selection. DNA was isolated from the transfected cells and the DNA sequence of each clone carrying the “C” allele was determined by Sanger sequencing. This procedure allowed us to obtain a HeLa CRISPR1 (T/C) cell line (using gRNA1) that was heterozygous for the ABCC10 rs2125739 SNP genotype and a HeLa CRISPR2 (C/C) cell line (using gRNA2) that was homozygous minor allele genotype within the SNP. Docetaxel sensitivity was measured in the HeLa parent cells and HeLa CRISPR-edited cells in the presence of 20 μM verapamil, added to the medium as described previously [20 (link)]. We carried out five or less subcultures until we established CRISPR-edited cells from HeLa parent cells.