Anti tyrosine hydroxylase

The brains were fixed and processed for immunostaining as described previously [31 (link)]. The primary antibodies used in this study were as follows: rabbit polyclonal anti-tyrosine hydroxylase (TH) (1:1000; Abcam, Cambridge, CA, USA) and ionized calcium-binding adaptor molecule-1 (IBA-1) (1:200, Proteintech, Chicago, IL, USA). To determine cell numbers, total nigral TH-positive cells were counted by three researchers blind to the experimental design, and the average of these scores were reported.

SDS-PAGE, immunoblotting, and real-time PCR analyses were performed as previously described.^{62 (link),63 (link)} Gel electrophoresis was conducted using the NuPAGE system with 4–12% pre-cast gradient gels and MES/SDS running buffer (Thermo Fisher Scientific, Waltham, MA). For human mesencephalic tissues, primary antibodies for NLRP3 were the same as described above. The following antibodies were used for cell culture lysates and immunoprecipitation assays: anti-NLRP3/NALP3 (Adipogen, San Diego, CA; Cell Signaling Technology, Danvers, MA), anti-c-Myc [9E10] (Abcam, Cambridge, MA), anti-Ubiquitin (Cell Signaling, Danvers, MA), anti-BiP (HSPA5) (Cell Signaling, Danvers, MA), anti-Nurr1 (Santa Cruz Biotechnology, Dallas, TX), anti-tyrosine hydroxylase (Abcam, Cambridge, MA), and anti-actin horseradish peroxidase (HRP)-coupled (Sigma-Aldrich, St. Louis, MO) antibodies. Immunoreactivity was detected using HRP-conjugated anti-rabbit and anti-mouse secondary antibodies (Millipore, Billerica, MA) as appropriate in combination with a chemiluminescent detection method (ECL-Plus, Thermo Fisher Scientific, Waltham, MA). NLRP3 transcripts were analyzed using real-time PCR with amplification detected using SYBR Green (Bio-Rad Laboratories, Hercules, CA), NLRP3 forward primer: CACTTCCAGTTTTTGCCGGG, and NLRP3 reverse primer: GGGAATGGCTGGTGCTCAAT.

Mice were transcardially perfused with 0.9% saline, followed by 4% paraformaldehyde for tissue fixation. The corpus striatum was dissected from brain according to the mouse brain atlas, and immediately frozen in liquid nitrogen until further use. Striatal tissues were fixed in cold 4% paraformaldehyde and embedded in paraffin. For IHC, the brain tissue slide was deparaffinized. Sections were incubated with primary anti-body: anti-Tyrosine Hydroxylase (1:500; Abcam) for 60 min followed by goat-anti mouse IgG (1:1,000; Abcam) for 30 min at room temperature and visualized with diaminobezidin (DAB) reagent. After counterstaining with hematoxylin, all slices were detected using an optical microscope(CX31;Olympus, Tokyo, Japan).