Lc480 system

Total RNA was extracted using TRIzol reagent (Takara) according to the manufacturer’s instructions. Next, a Reverse Transcription System (Promega) was used to translate 1 μg of RNA into complementary DNA. Real-time PCR was carried out with the LC480 system (Roche) using SYBR Green Supermix (Takara). The primers used in the experiment are listed in Supplementary Table 1. Data were normalized to 36B4 and analysed by the ΔΔCT method.

Placental tissue was ground in liquid nitrogen, and then total RNA was extracted with TRIzol reagent (Invitrogen, Waltham, MA) following the manufacturer’s instructions. Microspectrophotometry and gel electrophoresis were used to test the purity and integrity of RNA. For PCR of mRNA, RNA was reverse transcribed using HiScript III RT SuperMix (Vazyme, Nanjing, China). qPCR was performed using ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China) on the LC480 system (Roche, La Jolla, CA, USA). The specific primer was listed in the data supplementary. The relative expression slevels were calculated using the 2^{(−△△CT)} method.

RNA was extracted from cell and tissue samples from the MDA-MB-231^Trans−ER/MDA-MB-231^WT group with different ratios. Specific primers were used to amplify the ERα, human epidermal growth factor receptor 2 (HER2), and progesterone receptor (PR) from the cDNA. Briefly, 1 μg of the total RNA was reverse transcribed in a total reaction volume of 20 μL using 1 μL each of iScript reverse transcriptase and 5 × iScript reaction mix. The resulting cDNA was then diluted to 20 μL with RNase-free water (H₂O) and each RT-PCR sample consisted of 1 μL diluted RT product, 1 × SYBR Premix Ex Taq™ II 10 μL, and 0.4 μmol each of the forward and reverse primers. Reactions were conducted by using an LC480 system (Roche, USA) for 40 cycles (95°C for 5 s and 60°C for 30 s) after an initial 30 s incubation at 95°C.

Total RNA was isolated from all samples using the miRNeasy Kit (Qiagen) according to the manufacturer’s protocol. A defined amount of cel-miR-39-3p Caenorhabditis elegans oligo-ribonucleotide was added at the same time as the Qiazol reagent to assess efficiency of total RNA recovery. CDNA synthesis was performed using SuperScript^™ II RT (Invitrogen) according to manufacturer’s instructions. QRT-PCR was performed using the lightcycler LC480 system (Roche Diagnostics), specific primer set (Forward- hsa-miR-1246: aatggatttttggagcagg, and cel-miR-39-3p: tcaccgggtgtaaatcagcttg, and Reverse- Universal primer, Qiagen) and miScript PCR Starter kit (Qiagen) according to manufacturer’s instructions. The following conditions, 95°C for 5 s, followed by 35 cycles at 95°C for 10 s, 60°C for 20 s, 72°C for 20 s (measuring the fluorescence) were used for the qRT-PCR. At least three biological replicates were used. In order to carry out absolute miRNA quantification, a serial dilution of known concentration of miRNA mimic was used to plot a standard curve.

Frozen mouse tissues were homogenized with RNAiso Plus (TaKaRa). The lysate was transferred to a microcentrifuge tube and extracted with chloroform. RNA in the aqueous phase was precipitated with isopropanol, washed with 75% ethanol, and dissolved in RNase-free water. Reverse transcription of RNA (0.4 μg) was carried out using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, FSQ-301) according to the manufacturer’s protocol. Quantitative RT-PCR reactions contained 20 ng of cDNA, 410 nM of each primer, and 6 μl of SYBR Green PCR Master mix (THUNDERBIRD SYBR qPCR Mix QPS-201, Toyobo) in a total volume of 12 μl. The PCR reaction (95 °C for 1 minute followed by 45 cycles of 95 °C for 10 seconds, 60 °C for 40 seconds) was performed on Roche LC480 system. Relative mRNA levels were calculated by the comparative threshold cycle method using cyclophilin as an internal control. The sequence of the primers for osteopontin, Ngal, MCP1, Runx2, and osteocalcin were shown in Supplementary Table 3.

The qRT-PCR experiments were conducted in a 20 ml reaction volume using the LC480 system (Roche, USA) with three biological replicates. The tobacco Actin gene (accession No.: X63603) was used as an internal standard for normalization, and SYBR Green served as the fluorochrome. A three-step PCR process was performed with a pre-denaturation at 95°C for 30 s, followed by 45 cycles of denaturation at 95°C for 15 s, annealing at the optimal temperature of each primer pair for 15 s, and elongation at 72°C for 20 s, and finally for melting point curve analysis (95°C for 5 s, 70°C for 1 min and 95°C for 15 s) to test amplicon specificity. Relative quantification of gene expression levels was calculated using 2^-△△Ct method. Sequence information of the qRT-PCR primers are listed in Supplementary Table 8.