Amersham ecl western blotting reagent

We followed published method for dot blot analysis with some modifications (Radle et al., 2013 ). In brief, equal amount of RNA (in binding buffer) from different experimental groups, was applied to Zeta membrane (Bio-Rad). A biotin-labeled DNA oligo was used as a positive control. The membrane was air-dried at room temperature for 5 minutes, followed by blocking at room temperature for 30 minutes with 10% SDS in PBS and 1mM EDTA. Next, the membrane was incubated in a solution containing 10% SDS in PBS and Streptavidin-HRP (Thermo Fisher Scientific) for 15 minutes at room temperature, followed by three washes with PBS containing SDS for 5 minutes each. After the final wash, biotinylated RNA were detected with Amersham ECL Western Blotting Reagent (GE Healthcare Life Sciences) using Amersham Imager 600 (GE Healthcare Life Sciences). For Northern blot analysis, 30 μg of RNA was denatured and run on a 15% acrylamide 7M urea gel, followed by transfer to a positively charged nylon membrane and UV-crosslinking. The membrane was next incubated with Streptavidin-HRP, washed and detected using ECL reagent, as above. For Northern blot analysis of tRNA fragments (Supplemental Figure S5), we used the following probes: 3′tRF GlyGCC 5′ TGCATTGGCCGGGAACCGAACCCGGGCCTCCCGCG 3′ and 3′tRF Val CAC 5′ TGTTTCCGCCCGGTTTCGAACCGGGGACCTTTCGCG 3′

To verify the purity of the fractions, the nuclear and cytoplasmic fractions were separated on 4–12% NuPage Gels (Thermo Fisher Scientific) and transferred to nitrocellulose membranes (GE Healthcare Life Science), followed by the incubation with primary antibodies against α-tubulin (Cell Signaling Technologies, #3973, 1:2000) and Lamin A/C (Sigma Life Science, #SAB4200236, 1:1000). Primary antibodies were detected using HRP-labeled secondary antibodies (Cell Signaling Technologies) and Amersham ECL Western Blotting reagent (GE Healthcare Life Science) or Supersignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) using a ChemiDoc Imaging System (Bio-Rad Laboratories; Supporting information Fig. S1).