Evagreen qpcr mix plus

Real time qPCR was performed on qacA/B positive isolates. The total RNA was extracted using Qiagen RNeasy Kit (Qiagen Valencia, CA, USA) and cDNA was synthesized (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems) and used as a template for qPCR amplification using SYBR Green method (EvaGreen qPCR Mix Plus, Solis Biodyne) using the primers described previously (Furi et al., 2013 (link)). Two TaqMan probes with two different fluorophores at the 5 = end and a minor groove binder (MGB) at the 3 = end (Applied Biosystems, United Kingdom) were used in order to distinguish between qacA and qacB. Qualitative real-time PCRs were performed in a Light Cycler 480 system (Roche Diagnostics, Germany). Melt curve analysis was performed along with the amplification protocol to determine if non-specific products were amplified during the reaction. The Ct (cycle threshold) value and melting curve analysis was used to confirm the presence of one peak and one product. Further agarose gel analysis (3%) was performed to confirm the amplification of a single PCR product.

Total RNA was extracted from tissues using Trizol according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). Total RNA (1 µg) was used to synthesize cDNA with ImProm-II reverse transcriptase (Promega, Madison, WI, USA). Real-time PCR was performed on a CFX96 sequence detection system (Bio-Rad, Hercules, CA, USA) using EvaGreen qPCR Mix Plus (Solis BioDyne, Estonia). Expression levels were normalized to the amount of 18S rRNA. Relative mRNA levels were then calculated by the difference in C_t values among animal groups, expressed as the fold change.

Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from samples, according to the manufacturer's protocol. cDNA was synthesized from 1 µg of total RNA after being primed by random hexamers through reverse-transcription by ImProm-II Reverse Transcriptase (Promega, Madison, WI, USA), according to the manufacturer's directions. Quantitative PCR was performed on a CFX96 sequence detection system (Biorad, Hercules, CA, USA) using EvaGreen qPCR mix plus (Solis BioDyne, Estonia). The levels of expression were normalized relative to the amount of 18S rRNA. Relative mRNA levels were calculated by differences in C_t values and are expressed as the fold change.

The Quick RNA miniprep from yeast cells using glass beads for cell lysis was performed as previously described in (38 (link)). After TurboDNAse digestion (Ambion, cat # AM2238), cDNA was synthesized using the high-capacity cDNA reverse transcription kit (Applied Biosystems, # 4368813). Quantitative polymerase chain reaction (qPCR) was performed using 5 × HOT FIREPol EvaGreen qPCR Mix Plus (Solis BioDyne # 08-25-00020). The obtained data were normalized to the reference 5S rRNA; at least two individual experiments were performed. qPCR primers are listed in Supplementary Table S3.

qPCRs were performed in triplicates using LightCycler 480 SYBR Green I Master (Roche) with cDNA from Hdh cells and 3-NP-treated cultured cortical neurons and 5× HOT FIREPol EvaGreen qPCR Mix Plus (Solis Biodyne) with R6/1 mouse brain cDNAs on LightCycler 480 II Real Time PCR System (Roche). Levels of Sdha or Hprt1 (for HD cell model experiments: Hdh and 3-NP-treated neurons, respectively) or geometric mean of Hprt1, Gapdh, and Tbp (for R6/1 mouse experiments) mRNA levels were used to normalize qPCR data. Primer pairs used in qPCR are shown in Table 3.

For qRT-PCR analysis, two weeks-old Arabidopsis plants were grown under the same conditions as described for growth measurements. Total RNA was isolated as described for RNAseq analysis. One microgram of DNase-treated RNA was used for cDNA synthesis using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qRT-PCR was performed on 3 μl of 20× diluted cDNA templates using 5× HOT FIREPol EvaGreen qPCR Mix Plus (Solis Biodyne) in a final volume of 8 μl, and Bio-Rad CFX96 Touch Deep Well Real-Time PCR System. Mean values of polyubiquitin 10 (UBQ10, AT4G05320) and glyceraldehyde-3-phosphate dehydrogenase C2 (GAPC2, AT1G13440) Ct were used as internal reference. Normalized relative transcript levels were obtained by the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)). Experiments were repeated with three biological replicates. Oligonucleotides used in this study are listed in Supplementary Table 12.

According to the manufacturer's protocol, total RNA isolation from serum samples was performed using a Sansure Mag kit (Sansure Biotech, China). Eventually, the quality and quantity of isolated RNA were validated photometrically by a Synergy HTX Multi‐Mode Microplate Reader (BioTek Instruments, Winooski, Vermont, USA). Furthermore, the total RNA integrity was assessed through electrophoretic approach. We synthesized complementary DNA (cDNA) using a PCR Biosystems cDNA synthesis kit (PCR Biosystems, Wayne, Pennsylvania, USA). After that, the real‐time PCR procedure was performed to determine circRNAs expression levels using EvaGreen qPCR Mix Plus (Solis BioDyne, Teaduspargi, Tartu, Estonia) on rotor gene 6000 thermal cycler apparatus (Corbett life science). The primer sequences applied in this study were as follows: circ‐ELP3 forward, 5′‐CAGCATCAGGGATTTGGCAT‐3′, circ‐ELP3 reverse, 5′‐CGACACTGTATTCCGAGGTCTT‐3′, circ‐FAF1 forward, 5′‐ACAAGTATCCCCGTTCGCC‐3′, circ‐FAF1 reverse, and 5′‐CTTCCACATCTCCCGTCTTCC‐3′. Finally, β‐Actin gene was used as the reference gene. The relative expression levels were normalized with the β‐Actin gene expression. We performed analysis using the comparative cycle threshold 2^−ΔΔCt method for RNA expression levels.