Beyort q first strand cdna synthesis kit

Total RNA was extracted with a TRIeasy™ Plus Total RNA Kit (Cat# 19211ES60, Yeasen, China) according to the manufacturer's protocol. The extracted RNA (400 ng) was treated with DNase I and then reverse-transcribed into cDNA by a BeyoRT™ Q First Strand cDNA Synthesis Kit (Beyotime) according to the manufacturer’s protocol. Real-time PCR was performed using the Step One Real-Time PCR system (ABI). The expression levels of RNA were normalized to β-actin. The sequences of the primers used for real-time PCR were:
β-actin: 5′-TTTGCAGCTCCTTCGTTGC-3′ (F).
5′-TCGTCATCCATGGCGAACT-3′ (R).
IFNβ: 5′-CCAGCTCCAAGAAAGGACGA(F).
5′-CGCCCTGTAGGTGAGGTTGAT-3′ (R).

In accordance with the manufacturer’s instructions, an Oriscience Prime RNA Extraction Kit (Oriscience, China) was used to obtain total RNA from colon cancer cells and colorectal cancer tissues. The obtained total RNA was reverse transcribed into cDNA using the BeyoRT™ Q First Strand cDNA Synthesis Kit (Beyotime, China) according to the instructions. Finally, qRT-PCR was performed using BeyoFast™ SYBR Green qPCR Mix (2X) (Beyotime, China) on the LightCycler 96 (Roche, Switzerland). The internal reference we use is GAPDH. The target gene RNA was obtained by 2-ΔΔCt algorithm. The primer sequence is GAPDH-F GGAGTCCACTGGCGTCTTCA GAPDH-R GTCATGAGTCCTTCCACACGATACC OLFM2-F TCCTTGAGTTGCGGACGTATC OLFM2-R GCCGGAGAGATTCCTCACC.