DNA staining dye 20 × EvaGreen was purchased from Biotium (Fremont, CA). Deoxynucleotide (dNTP) solution mix (10 mM of each), Bst 2.0 WarmStart DNA polymerase (8 U/μL), Mg2SO4 (100 mM), 10 × Isothermal Amplification Buffer (200 mM Tris–HCl, 500 mM KCl, 100 mM (NH4)2SO4, and 20 mM MgSO4, 1.0% Tween 20 and pH 8.8 at 25 °C) were purchased from New England BioLabs (Ipswich, MA). The ribonuclease RNase H2 (50 U at 2 U/μL) (Dilution Buffer included), primers, CHB and molecular beacon probes, and the pUCIDT (Amp) plasmid containing 300-bp B. burgdorferi recA gene sequence, or 300-bp Enterovirus 71 (EV71) VP1 gene sequence were purchased from or synthesized by Integrated DNA Technologies (Coralville, IA). DNA was extracted from each tick individually, using a MACHEREY–NAGEL nucleospin tissue kit (MACHEREY–NAGEL GmbH & Co. KG, PA, USA). Maestrogen UltraSlim LED blue light illuminator was purchased from Fisher Scientific (Pittsburgh, PA).
Deoxynucleotide dntp solution mix
Manufactured by New England Biolabs
Sourced in United States
The Deoxynucleotide (dNTP) solution mix is a laboratory reagent that contains a balanced mixture of the four deoxynucleotides (dATP, dCTP, dGTP, and dTTP) required for various DNA-based molecular biology applications. The solution provides a convenient source of the essential building blocks for DNA synthesis and amplification.
Automatically generated - may contain errors
Lab products found in correlation
Bst 2.0 warmstart dna polymerase, by New England Biolabs (2 mentions)
T4 dna ligase, by New England Biolabs (2 mentions)
Oligonucleotide, by Integrated DNA Technologies (2 mentions)
Sybr safe, by Thermo Fisher Scientific (2 mentions)
Amersham imager 600, by GE Healthcare (2 mentions)
Isothermal amplification buffer, by New England Biolabs (1 mentions)
Evagreen, by Biotium (1 mentions)
Nh4 2so4, by New England Biolabs (1 mentions)
T4 dna ligase reaction buffer, by New England Biolabs (1 mentions)
Pierce universal nuclease for cell lysis, by Thermo Fisher Scientific (1 mentions)
Q5 high gc enhancer, by New England Biolabs (1 mentions)
L selenocystine, by Thermo Fisher Scientific (1 mentions)
L cysteine hydrochloride monohydrate, by Thermo Fisher Scientific (1 mentions)
Q5 reaction buffer, by New England Biolabs (1 mentions)
Hispur cobalt resin, by Thermo Fisher Scientific (1 mentions)
Dpni, by New England Biolabs (1 mentions)
Q sepharose fast flow, by GE Healthcare (1 mentions)
T4 polynucleotide kinase, by New England Biolabs (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Biotin, by Merck Group (1 mentions)
11 protocols using deoxynucleotide dntp solution mix
1
Rapid Detection of Tick-Borne Pathogens
2
Purification of Recombinant Proteins
3
Enzymatic Modification of Biomolecules
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EnGen Lba Cas12a (Cpf1), 10X NEBuffer™ 2.1 buffer, Klenow fragment (3′ → 5′ exo-), 10X NEBuffer™ 2, deoxynucleotide (dNTP) solution mix, nicking endonuclease (Nb.BbvCI) were purchased from New England Biolabs Ltd. (Whitby, ON, Canada). Streptavidin from Streptomyces avidinii and biotin were purchased from Sigma (Oakville, ON, Canada). IL-6 protein and polyclonal anti-IL-6 antibodies were purchased from Thermo fisher Scientific (Mississauga, ON, Canada). Human serum, magnesium chloride hexahydrate (MgCl2·6H2O), and 100× Tris–EDTA (TE, pH 7.4) buffer were purchased from Sigma-Aldrich (Mississauga, ON, Canada). NANOpure H2O (>18.0 MΩ), purified using an Ultrapure Mili-Q water system, was used for all experiments. All DNA samples and the guide RNAs were Integrated DNA Technologies (Coralville, IA) and purified using high-performance liquid chromatography.
4
Transgene Expression Analysis in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
Pdgfrα‐H2BGFP transgene expression was determined by detecting GFP expression upon light illumination of the head with a BlueStar flashlight (Nightsea, Lexington USA) at P1‐P2. Cre recombinase and Rosa26‐YFP transgene expression was evaluated by polymerase chain reaction (PCR) of genomic DNA extracted from ear biopsies as previously described (O'Rourke et al.,2016 ). MAPT and APP transgenes were also detected by PCR using Taq DNA polymerase with a standard magnesium‐free Taq buffer (M0329L; New England BioLabs), the deoxynucleotide (dNTP) solution mix (N0447L; New England BioLabs), and the following primers: MAPT 5′ GGG GAC ACG TCT CCA CGG CAT CTC AGC AAT GTC TCC and MAPT 3′ TCC CCC AGC CTA GAC CAC GAG AAT, or APP 5′ GGT GAG TTT GTA AGT GAT GCC and APP 3′ TCT TCT TCT TCC ACC TCA GC. Each reaction was heated to 94°C for 4 min and amplified across 35 cycles of 94°C for 30 s, 57°C for 45 s, and 72°C for 60 s, followed by a final 10 min at 72°C, to yield DNA fragments of ~350 bp and ~360 bp, respectively. MAPT and APP PCR products were run on a 2% (w/v) agarose gel in TAE containing SYBR‐safe (Thermo Fisher Scientific) and visualized using an Amersham Imager 600 (GE Healthcare Life Sciences, UK).
+ Expand
Pdgfrα‐H2BGFP transgene expression was determined by detecting GFP expression upon light illumination of the head with a BlueStar flashlight (Nightsea, Lexington USA) at P1‐P2. Cre recombinase and Rosa26‐YFP transgene expression was evaluated by polymerase chain reaction (PCR) of genomic DNA extracted from ear biopsies as previously described (O'Rourke et al.,
5
PCR Amplification of Anopheles ITS2 Region
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplification of the ITS2 region was performed with Hot FirePol DNA Polymerase Kit (Solis Biodyne). Total PCR mix volume per sample was 50 μL with 48 μL premix and 2 μL DNA. The premix contained 36.8 μL H2O, 5 μL 10× Buffer B1, 3 μL 25 mM MgCl2, 1 μL 10 mM Deoxynucleotide (dNTP) Solution Mix (New England BioLabs), 1 μL 10 nM Forward ITS2 Primer, 1 μL 10 nM Reverse ITS2 Primer and 0.2 μL (5 U/μL) Hot FirePol DNA Polymerase. The DNA was either undiluted for extracted midguts and legs or diluted at 1/10 in DNAse‐/RNAse‐free water for extracted carcasses. Anopheles ITS2 primer sequences are 5′‐TGTGAACTGCAGGACACAT‐3′ (Forward) and 5′‐TATGCTTAAATTCAGGGGGTAG‐3′ (Reverse) (Saul & Beebe, 1995 (link); Vezenegho et al., 2022 (link)). PCR was performed on a SimpliAmp Thermal Cycler (Applied Biosystems) using the cycle: 95°C × 15 min, (95°C × 30 s, 56°C × 45 s, 72°C × 40 s) × 35 cycles, 72°C × 10 min, 4°C × ∞. Amplified DNA was either used directly after or stored at 4°C or −20°C until use.
6
Quantification of Dabigatran Metabolites
7
Strep-Tag Protein Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pASG-IBA2 Star Gate Acceptor Vector, Strep-Tactin Superflow (high capacity; 6% crosslinked agarose; 60–160 µm) resin and Strep-tag protein purification buffer set were purchased from IBA Life Sciences. p-nitrophenyl butyrate (p-NPB) was from Sigma. Oligonucleotides were from Integrated DNA Technologies. Fast digest restriction endonucleases (Esp3I, Hind III, NdeI, Xho I) and T4 DNA ligase enzymes were from Thermo Fisher Scientific. Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs. Ampicillin was from G-Biosciences. Anhydrotetracycline hydrochloride, 4-morpholineethanesulfonic (MES) acid monohydrate and MES sodium salt were purchased from Acros Organics. Blue-Clean Protein Stain was purchased from IBI Scientific. Coomassie G-250 (Bradford) dye and bovine serum albumin were purchased from Thermo Scientific. 12% precast polyacrylamide gels for use with Mini-PROTEAN Electrophoresis Cells, Poly-Prep Chromatography Columns (2 ml bed volume and 10 ml reservoir), Precision Plus Protein All Blue Standards and Precision Plus Protein Dual Color Standards were from Bio-Rad. Commercial CALB was from Chiral Vision (CV-CALBY).
8
CRISPR-Cas13a RNA detection protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nutrient broth (NB) (NO. HB0108) and Luria-Bertani (LB) medium (NO. HB0129) were purchased from Qingdao Hope Bio-Technology Co., Ltd. (Qingdao, China). All DNA oligonucleotides used in this study (Table S1 ) were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and purified by high-performance liquid chromatography (HPLC). The poly U reporter purified by HPLC was purchased from Takara Bio Inc. (Dalian, China). LwaCas13a protein (1000 pmol) (NO. 32117) was procured from Tolo Biotech Co., Ltd. (Shanghai, China). RT7 RNA polymerase (20 U/μL) (NO. EP0111), Phi29 DNA polymerase (10 U/μL) (NO. EP0094), and TRIzol reagent (cat. NO. 15596026) were procured from Thermo Fisher Scientific (Waltham, USA). RNase H (5 U/μL) (NO. M0297), ProtoScriptII reverse transcriptase (200 U/μL) (NO. M0368S), deoxynucleotide (dNTP) solution mix (10 mM) (NO. N0447S), and ribonucleotide (rNTPs) solution mix (25 mM) (NO. N0466S) were procured from New England Biolabs (Ipswich, MA, USA). MgCl2 (1 M) (NO. M1028), KCl (1 M) (NO. 60142), DMSO (NO. D8418), Tris-HCl (pH 8.0) (NO. T3069), and isopropanol (NO. I9516) were procured from Merck KGaA (Darmstadt, Germany). The nucleic acid loading buffer (6 ×) and DNA maker (25–500 bp) (NO. B600303), and the agarose were bought from Sangon Biotech Co., Ltd. GelRed Nucleic (NO. 41003) was obtained from Biotium (Fremont, CA, USA).
9
Nucleic Acid Detection Protocol
10
Detecting MAPT Transgene by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA extractions and the detection of the Cre recombinase and the Rosa26‐YFP transgenes by polymerase chain reaction (PCR) were carried out as previously described (O’Rourke et al., 2016 ). Each PCR to detect the MAPT transgene was carried out using Taq DNA polymerase with standard Magnesium‐free Taq buffer (M0329L; New England BioLabs) and deoxynucleotide (dNTP) solution mix (N0447L; New England BioLabs), with the following primers: MAPT 5′ GGG GAC ACG TCT CCA CGG CAT CTC AGC AAT GTC TCC and MAPT 3′ TCC CCC AGC CTA GAC CAC GAG AAT, and was heated to 94°C for 4 min and amplified across 35 cycles of 94°C for 30s, 57°C for 45s and 72°C for 60s, followed by a final 10 min at 72°C, to yield a DNA fragment of ~350 bp. DNA products were run on a 2% (w/v) agarose gel in TAE containing SYBR safe (Thermo Fisher Scientific) and visualised using an Amersham Imager 600 (Ge Healthcare Life Sciences, UK).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!