Cas9 knock in mice

The Cas9 Knockin mice (stock number 026179), C57BL/6-Ly5.1 (stock number 002014) and C57BL/6-Ly5.2 (stock number 000664) mice were ordered from Jackson Labs (Bar Harbor, ME). Mice were used at 6–8 weeks of age. All mice were maintained in a specific pathogen-free facility and routinely checked for health conditions. Mice received bone marrow transplantation were housed in sterile cages with autoclaved bedding and food. Antibiotic were given to the drinking water for up to 6 weeks post-transplantation. Hydration supplement, such as H-gel, were also provided to alleviate discomfort. Animals were euthanized using CO₂ prior to tissue collections. All studies involving animals were performed according to protocols reviewed and approved by the AbbVie Institutional Animal Care and Use Committee (IACUC).

For CRISPR/gRNA studies, Cas9 knock-in mice from Jackson Laboratory (Strain# 024857) (Platt et al., 2014 (link)) were bred to mice expressing CRE recombinase under control of mouse beta-Actin promoter. From this breeding, E13.5 embryos were dissected and embryonic DRGs seeded and cultured as described above. For analysis of NMNAT2 protein levels after depletion of MKK4/7, DRGs were infected with lentivirus on DIV1. Cells were lysed on DIV 8 and cell extracts analyzed by western immunoblotting. For suppression of axon protection experiments, DRGs were infected with Bcl-XL and shRNAs on DIV 3 and gRNA to Nmnat2 or scrambled control on DIV 4. Axons were not fragmented spontaneously with gRNA to Nmnat2 during the course of the experiment. Scrambled gRNAs (CGTCGCCGGCGAATTGACGG and CGCGGCAGCCGGTAGCTATG), Map2k4 (MKK4) gRNAs (TTGTTTTACAGGGCGACTGT and TTTGTAAAACTTATCGAACG), Map2k7 (MKK7) gRNAs (TTGCAGCAAATGCGGCGCT and CCAAAGCACTGAACGATGTA), Nmnat2 gRNA (GGAGCCCACCTGTTTTCCGT). gRNAs were designed with help from the Genome Engineering and iPSC center. gRNA sequences were cloned into LentiGuide-puro plasmid (Addgene # 52963).

Cas9 knock-in mice were obtained from Jackson Laboratories (Stock# 026179). All animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the Korea Research Institute of Chemical Technology (2018-8A-11-01 and 2019-8B-04-01). Sex- and age-matched six-to-twelve-week-old Cas9 knock-in mice were divided into two groups. The first group was injected intraperitoneally with 5 × 10¹¹ viral genome (vg) of AAV8 sg-ACBD3. The second group received the same dose of AAV8 sg-Cont. Two weeks after AAV8 infection, both groups were administered CVB3-H3 at 1 × 10⁶ TCID₅₀ for 3 days by intraperitoneal injection.