For miR target validation, the putative (seed) binding site of miR-101-3p in the 3′UTR of COX-2 predicted by TargetScan 7.2 (position 1737-1744 of PTGS2 3’ UTR) and the mutant (MUT) 3′UTR of COX-2 with one nucleotide substitution were cloned into pmirGLO Dual-Luciferase miRNA Target Expression Vector (pmirGLO-empty, Promega, USA) downstream of the firefly luciferase gene (XbaI and Nhe sites) to obtain Luc Reporter Construct (pmirGLO-seed and pmirGLO-mut). The primers used for cloning 172 bp of 3′-UTR-COX2 in pmirGLO vector: Forward 5′AAGCTAGCTGATATCTAAGTAGTTCTCAGC 3′; Reverse 5′AATCTAGACAATGATTGTAGGCTTAAACAC 3′ (seed). The mutant primers used to introduce a mutation by site directed mutgenesis (GeneArt Site-Directed Mutagenesis, invitrogen, USA) are the following: Forward 5′ ATTTAATGGTATTGTATATTACTTA 3′; Reverse 5′ TAAGTAATATACAATACCATTAAAT 3′ (mut). MDA-MB-231 cells were plated at a density of 105 cells/well in a 96-well plate and co-transfected with pmirGLO-empty (100 ng), pmirGLO -seed (100 ng), miR-101 mimic (5 nM) and negative scrambled control depending on treatments and following Lipofectamine 3000 reagent protocol. Cells were harvested 24 h after transfection and cell lysates were used for Dual-Luciferase® Reporter Assay System analysis according to the manufacturer’s instructions (Promega, USA).
Dual luciferase reporter assay system analysis
Manufactured by Promega
Sourced in United States
The Dual-Luciferase® Reporter Assay System is a laboratory tool that simultaneously measures the activity of two different luciferase reporter enzymes within a single sample. This system allows for the normalization of experimental data by providing an internal control, enabling more accurate and reliable analysis of gene expression and regulation.
Automatically generated - may contain errors
Lab products found in correlation
Pmirglo dual luciferase mirna target expression vector, by Promega (2 mentions)
Geneart site directed mutagenesis, by Thermo Fisher Scientific (1 mentions)
Prl tk renilla luciferase plasmid, by Addgene (1 mentions)
Pgl3 basic, by Addgene (1 mentions)
Veritas microplate luminometer, by Promega (1 mentions)
Pgl3 basic plasmid, by Promega (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
3 protocols using dual luciferase reporter assay system analysis
1
Validation of miR-101-3p Targeting COX-2
2
Validating miR-623 Target MMP1 via Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miR-623 target validation, the wild-type (WT) putative binding site of miR-623 in the 3′UTR of MMP1 predicted by TargetScan (edition7.2) (position 420–426 of MMP1 3’UTR), and the mutant (MUT) 3ʹUTR of MMP1 with the seed region deleted, were cloned into pmirGLO Dual-Luciferase miRNA Target Expression Vector (pmirGLO-empty, Promega, USA) to create Luciferase reporter constructs.13 (link),14 (link) The following primers were used to clone 3′-UTR-MMP1 in pmirGLO vector:
miR623_MMPI_WT_F: 5ʹCTAGTGTGCAGTCACTGGTGTCACCCTGGATAGGCAAGGGATAACTCTTCTAACACAAAATAAGTGTTTTA3’;
miR623_MMPI_WT_R: 5ʹCTAGTAAAACACTTATTTTGTGTTAGAAGAGTTATCCCTTGCCTATCCAGGGTGACACCAGTGACTGCACA3’;
miR623_MMPI_Mut_F: 5ʹCTAGTGTGCAGTCACTGGTGTCACCCTGGATAGGTAACTCTTCTAACACAAAATAAGTGTTTTA3’;
miR623_MMPI_Mut_R: 5ʹCTAGTAAAACACTTATTTTGTGTTAGAAGAGTTACCTATCCAGGGTGACACCAGTGACTGCACA3’;
(100 ng) PmirGLO-MUT, (100 ng) pmirGLO-WT, (20 nM) miR-623 mimic, or negative scrambled control were co-transfected into MDA-MB-231 cells (ATCC) using the Lipofectamine 3000 reagent protocol. The Firefly and Renilla luciferase activities were assessed using the Dual-Luciferase® Re-porter Assay System analysis (cat# E2940, Promega, USA) after 24 hours of transfection according to the manufacturer’s recommendations, and the Firefly activities were subsequently normalized with Renilla luciferase.
miR623_MMPI_WT_F: 5ʹCTAGTGTGCAGTCACTGGTGTCACCCTGGATAGGCAAGGGATAACTCTTCTAACACAAAATAAGTGTTTTA3’;
miR623_MMPI_WT_R: 5ʹCTAGTAAAACACTTATTTTGTGTTAGAAGAGTTATCCCTTGCCTATCCAGGGTGACACCAGTGACTGCACA3’;
miR623_MMPI_Mut_F: 5ʹCTAGTGTGCAGTCACTGGTGTCACCCTGGATAGGTAACTCTTCTAACACAAAATAAGTGTTTTA3’;
miR623_MMPI_Mut_R: 5ʹCTAGTAAAACACTTATTTTGTGTTAGAAGAGTTACCTATCCAGGGTGACACCAGTGACTGCACA3’;
(100 ng) PmirGLO-MUT, (100 ng) pmirGLO-WT, (20 nM) miR-623 mimic, or negative scrambled control were co-transfected into MDA-MB-231 cells (ATCC) using the Lipofectamine 3000 reagent protocol. The Firefly and Renilla luciferase activities were assessed using the Dual-Luciferase® Re-porter Assay System analysis (cat# E2940, Promega, USA) after 24 hours of transfection according to the manufacturer’s recommendations, and the Firefly activities were subsequently normalized with Renilla luciferase.
3
Evaluating ESR1-LBD Promoter Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded in 24-well plate (2 × 105 cells/well) 1 day before transfection and treatments were added accordingly to the experimental design (not treated, vehicle/DMSO 0.01% or fulvestrant 1 µM). For the putative promoter experiment, three different human genomic DNA regions representing putative ESR1-LBD promoter (pESR1-LBD-1/2/3) were cloned into pGL3.basic plasmid (Promega, USA; Supplementary Data 7 ). BC cells were co-transfected with pGL3.basic (NC) or p-ESR1-LBD reporter plasmids (750 ng) and pRL-TK Renilla Luciferase plasmid (75 ng) (Addgene, USA) by using Lipofectamine 2000 (Invitrogen, USA) and following reagent protocol. For ERα-driven transcriptional activity experiment, BC cells were co-transfected with 3x-ERE-TATA-Luciferase reporter plasmid (750 ng) and pRL-TK Renilla Luciferase plasmid (75 ng) (Addgene, USA) by using the same procedure described above. Cells were harvested 24 h after transfection and cell lysates were used for Dual-Luciferase® Reporter Assay System analysis, according to the manufacturer’s instructions (Promega, USA). Luciferase bioluminescence measurements were performed with the Veritas™ Microplate Luminometer (Promega, USA). For each sample, Firefly luciferase activity was normalized against Renilla luciferase activity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!