Mutation surveyor software version 3

Manufactured by SoftGenetics

Sourced in United States

Mutation Surveyor software version 3.97 is a tool designed for DNA sequence analysis. It is used to identify and visualize mutations in DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Mutation Surveyor (114 citations) Mutation Surveyor software (101 citations) Mutation Surveyor version 3.0 (2 citations)

10 protocols using mutation surveyor software version 3

Targeted Sequencing of Key Cancer Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sanger sequencing included selected regions of BRAF, c‐KIT, EGFR, KRAS, NRAS, and PIK3CA and was performed using M13‐linked polymerase chain reaction primers designed to flank and amplify targeted sequences. Polymerase chain reaction products were bidirectionally sequenced using the BigDye Terminator version 1.1 chemistry, and analyzed using the 3730 DNA Analyzer (Applied Biosystems, Grand Island, NY). Sequence traces were analyzed using Mutation Surveyor software version 3.25 (Soft Genetics, State College, PA).

Koncar R.F., Feldman R., Bahassi E.M, & Hashemi Sadraei N. (2017). Comparative molecular profiling of HPV‐induced squamous cell carcinomas. Cancer Medicine, 6(7), 1673-1685.

+ Open protocol

+ Expand

Targeted Sanger Sequencing of Key Cancer Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sanger sequencing included selected regions of BRAF, cKIT, EGFR, KRAS, NRAS, and PIK3CA and was performed using M13‐linked polymerase chain reaction primers designed to flank and amplify targeted sequences. Polymerase chain reaction products were bidirectionally sequenced using the BigDye Terminator version 1.1 chemistry, and analyzed using the 3730 DNA Analyzer (Applied Biosystems, Grand Island, NY). Sequence traces were analyzed using Mutation Surveyor software version 3.25 (Soft Genetics, State College, PA).

Feldman R., Gatalica Z., Knezetic J., Reddy S., Nathan C., Javadi N, & Teknos T. (2015). Molecular profiling of head and neck squamous cell carcinoma. Head & Neck, 38(Suppl 1), E1625-E1638.

+ Open protocol

+ Expand

TP53 Mutational Analysis in FFPE Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

FFPE tissue blocks were cut as 8-μm sections and tumour-enriched regions were recovered by macrodissection based on regions marked on an adjacent haematoxylin-and-eosin-stained section by the study pathologist. DNA was extracted using the QIAamp DNA FFPE Tissue Kit (Qiagen) and quantified using a Qubit 2.0 Fluorometer (Invitrogen). Coding sequences of the TP53 gene (exons 2–11) were PCR-amplified from FFPE DNA using primers and conditions as described previously [34 (link)] and sequenced using an ABI 3730 DNA Analyzer (Applied Biosystems), except that an additional forward instead of reverse primer (5′-CAGGTCTCCCCAAGGCGCAC-3′) was used for the sequencing of exon 7. Mutational analysis was performed using Mutation Surveyor software version 3.97 (SoftGenetics), and sequence data were aligned to TP53 reference sequence NC_000017.10. In patients 127 and 200, mutations were identified in FFPE DNA by TAm-Seq (tagged-amplicon deep sequencing) using the 48.48 Access Array System (Fluidigm) and GAIIx Genome Analyzer (Illumina), as previously described [21 (link)].

Parkinson C.A., Gale D., Piskorz A.M., Biggs H., Hodgkin C., Addley H., Freeman S., Moyle P., Sala E., Sayal K., Hosking K., Gounaris I., Jimenez-Linan M., Earl H.M., Qian W., Rosenfeld N, & Brenton J.D. (2016). Exploratory Analysis of TP53 Mutations in Circulating Tumour DNA as Biomarkers of Treatment Response for Patients with Relapsed High-Grade Serous Ovarian Carcinoma: A Retrospective Study. PLoS Medicine, 13(12), e1002198.

+ Open protocol

+ Expand

Sequencing of p53 Gene Mutations

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from freshly frozen tissue using DNeasy blood and tissue kits (QIAGEN) and quantified using a Qubit 2.0 Fluorometer (Invitrogen). DNA quality was assessed by absorptiometric analyses. Coding sequences of the p53 gene (exons 2–11) were PCR-amplified using primers and conditions as described previously30 (link) and sequenced using an ABI 3730 DNA Analyzer (Applied Biosystems). Mutational analysis was performed using Mutation Surveyor software version 3.97 (Soft Genetics), and sequence data were aligned to the p53 reference sequence NC_000017.10.

Zhu G., Yang S., Wang R., Lei J., Ji P., Wang J., Tao K., Yang C., Ge S, & Wang L. (2021). P53/miR-154 Pathway Regulates the Epithelial-Mesenchymal Transition in Glioblastoma Multiforme Cells by Targeting TCF12. Neuropsychiatric Disease and Treatment, 17, 681-693.

+ Open protocol

+ Expand

Exon 5-9 p53 Mutation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from cell lines (QIAGEN QIAamp DNA kit). PCR amplification of exons 5 to 9 was performed using the primers shown in Table 5. Products were sequenced with the original PCR primers using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems). Sequences were analyzed using Mutation Surveyor software, version 3.97 (SoftGenetics).

Poon E., Liang T., Jamin Y., Walz S., Kwok C., Hakkert A., Barker K., Urban Z., Thway K., Zeid R., Hallsworth A., Box G., Ebus M.E., Licciardello M.P., Sbirkov Y., Lazaro G., Calton E., Costa B.M., Valenti M., De Haven Brandon A., Webber H., Tardif N., Almeida G.S., Christova R., Boysen G., Richards M.W., Barone G., Ford A., Bayliss R., Clarke P.A., De Bono J., Gray N.S., Blagg J., Robinson S.P., Eccles S.A., Zheleva D., Bradner J.E., Molenaar J., Vivanco I., Eilers M., Workman P., Lin C.Y, & Chesler L. (2020). Orally bioavailable CDK9/2 inhibitor shows mechanism-based therapeutic potential in MYCN-driven neuroblastoma. The Journal of Clinical Investigation, 130(11), 5875-5892.

+ Open protocol

+ Expand

CTNNB1 Mutation Detection in Tumors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutations in exon 3 of the CTNNB1 gene were detected in genomic DNA obtained from frozen tumour tissues using the Sanger direct method. The PCR reactions were carried out with the following primers: CTNNB1_3F:CCCTGGCTATCATTCTGCTT and CTNNB1_3R:TCTCTTTTCTTCACCACAACATTT using Amplitaq Gold DNA Polymerase (Roche, Basel, Switzerland) under the following conditions: 95 °C for 8 min; 35 cycles of 95 °C for 1 min; 57 °C for 5 min; 72 °C for 1 min, then a final extension step at 72 °C for 7 min. Sequencing reactions were performed using a Big-Dye Terminator v.3.1 Cycle Sequencing Kit (Life Technologies) according to the manufacturer's protocol. Sequencing products were analyzed in ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Sequences of the analyzed fragments were compared with the CTNNB1 cDNA (GenBank RefSeq: NM_001904.3) using Mutation Surveyor software version 3.30 (Soft Genetics, LLC, State Collage, PA, USA). The positions of the identified nucleotide changes were determined based on comparison with the reference sequence, with the A of the ATG translation initiation codon designated as nucleotide +1.

Trubicka J., Szperl M., Grajkowska W., Karkucińska-Więckowska A., Tarasińska M., Falana K., Dembowska-Bagińska B, & Łastowska M. (2016). Identification of a novel inherited ALK variant M1199L in the WNT type of medulloblastoma. Folia neuropathologica, 54(1).

+ Open protocol

+ Expand

Detecting BCOR Duplication in Tumor Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from 6 tumor samples, which showed positive HGNET-BCOR signature, using the QIAamp DNA FFPE Tissue Kit (Qiagen). The duplicated region in exon 15 of BCOR was detected by targeted PCR using the following primers, as described by Appay et al., 2017 [1 (link)]. BCOR_15F: TCCTCCCGCATATTTCGCTG and BCOR_15R: ACACACTGTACATGGTGGGTCC (35 cycles of 98 °C 10s, 60 °C 30s, 72 °C 120 s). Bidirectional sequencing was performed using a 3500 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). The sequences were determined on both DNA strands from at least two independent PCR products. The analyzed sequence fragments were compared with the BCOR cDNA (Gen-Bank RefSeq: NM_001123385.1) sequence using Mutation Surveyor software version 3.30 (Soft Genetics, LLC, State Collage, PA, USA).

Łastowska M., Trubicka J., Sobocińska A., Wojtas B., Niemira M., Szałkowska A., Krętowski A., Karkucińska-Więckowska A., Kaleta M., Ejmont M., Perek-Polnik M., Dembowska-Bagińska B., Grajkowska W, & Matyja E. (2020). Molecular identification of CNS NB-FOXR2, CNS EFT-CIC, CNS HGNET-MN1 and CNS HGNET-BCOR pediatric brain tumors using tumor-specific signature genes. Acta Neuropathologica Communications, 8, 105.

+ Open protocol

+ Expand

Genetic Analysis of Chromosomal Abnormalities

Check if the same lab product or an alternative is used in the 5 most similar protocols

To search for homozygous regions and possible chromosomal abnormalities, all available family members were genotyped with an Affymetrix® CytoScan™ Array. The primary data was analysed using Chromosome Analysis Suite (ChAS) software (Affymetrix). Direct sequencing of all coding exons and exon-intron boundaries of BBS5 was performed. Primer sequences are available upon request. PCR products were sequenced using BigDye™ Terminator Cycle Sequencing kit (PE Applied Biosystems, Bedford, MA, USA). Sequences were analysed using Mutation Surveyor® software Version 3.24 (SoftGenetics LLC, State College, PA 16803, USA). Mutations were labelled according to the Human Genome Variation Society (HGVS) recommendations version 2.0. A control DNA panel from 96 individuals from a Saudi Arabian population was used to screen for the novel sequence variant.

Al-Hamed M.H., van Lennep C., Hynes A.M., Chrystal P., Eley L., Al-Fadhly F., El Sayed R., Simms R.J., Meyer B, & Sayer J.A. (2014). Functional modelling of a novel mutation in BBS5. Cilia, 3, 3.

+ Open protocol

+ Expand

Genetic Profiling of Cancer Patients

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood sample were collected from all patients. Genomic DNA was extracted using the Wizard Genomic DNA purification kit (Promega Corporation, Madison, WI, USA) according to the manufacturer’s instructions.
For mutational analysis, we used the TruSight Sequencing Cancer Panel on a MiSeq platform (Illumina) that analyzes 14 genes, BRCA1(NM_007295), BRCA2(NM_000059), ATM (NM_000051.4), CHEK2(NM_007194),PALB2(NM_024675), RAD51C(NM_058216), RAD51D(NM_002878), NBN(NM_002485), CDH1 (NM_004360), TP53 (NM 000546), MLH1 (NM 000249), MSH2 (NM 000251), MSH6 (NM 000179.3), and PMS2 (000535.7).The presence of the point mutation was confirmed on the other blood sample by Sanger sequencing, as previously described [20 (link)]. The results were analyzed using Mutation Surveyor^® software, version 3.24 (Softgenetics, State College, PA, USA). Molecular analysis in family members of mutated probands was performed by Sanger sequencing, as previously described [21 (link),22 (link)].

Vietri M.T., D’Elia G., Caliendo G., Albanese L., Signoriello G., Napoli C, & Molinari A.M. (2022). Pancreatic Cancer with Mutation in BRCA1/2, MLH1, and APC Genes: Phenotype Correlation and Detection of a Novel Germline BRCA2 Mutation. Genes, 13(2), 321.

+ Open protocol

+ Expand

DNA Sequencing with Automated Variant Calling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR products were double-strand sequenced using BigDye Terminator sequencing chemistry (Life Technologies) and analyzed on an ABI 3130xL automatic DNA sequencer (Life Technologies, Carlsbad, CA, USA). Automatic variation calling was obtained by analyzing sequencing data (ABI file) using Mutation Surveyor software version 3.24 (SoftGenetics, State College, PA, USA), followed by careful inspection of the electropherograms to minimize variant loss.

Giugliano T., Santoro C., Torella A., Del Vecchio Blanco F., Grandone A., Onore M.E., Melone M.A., Straccia G., Melis D., Piccolo V., Limongelli G., Buono S., Perrotta S., Nigro V, & Piluso G. (2019). Clinical and Genetic Findings in Children with Neurofibromatosis Type 1, Legius Syndrome, and Other Related Neurocutaneous Disorders. Genes, 10(8), 580.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!