Raw264.7 cell lines were cultured in DMEM (Gibco) supplemented with 10% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin and 10 μg/ml gentamycin. One day prior to treatment, 1 x 106 cells/well were seeded on a 6-well plate. Cells were treated with 0, 0.2, 0.4, 0.8 mg/ml of lidocaine for 2 h and subsequently stimulated with LPS for 10 min. Cells were washed with cold PBS, lysed with NP–40 lysis buffer containing protease inhibitor cocktail (GenDepot) and incubated with continuous agitation at 4°C for 30 min. After centrifugation at 13,000 g for 15 min, supernatants were taken and 30 μg of protein were used for SDS-PAGE. Protein samples were transferred to Immobilon-P PVDF membrane (Millipore). The following antibodies were used for western blot analysis: anti-IκB-α (L35A5, 1:1000 dilution, Cell Signaling Technology), anti-β-actin (AC–15, 1:5000 dilution, Abcam), anti-mouse IgG-HRP (sc–2005, 1:5000 dilution, Santa Cruz Biotechnology).
Anti β actin ac 15
Manufactured by Abcam
Sourced in United States
Anti-β-actin (AC-15) is a mouse monoclonal antibody that recognizes the beta isoform of the actin protein. It can be used as a loading control in Western blotting applications to detect the ubiquitously expressed beta-actin, which is often used as a reference for data normalization.
Automatically generated - may contain errors
Lab products found in correlation
Protease inhibitor cocktail, by GenDEPOT (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Immobilon p pvdf membrane, by Merck Group (1 mentions)
Anti iκbα l35a5, by Cell Signaling Technology (1 mentions)
Anti mouse igg hrp sc 2005, by Santa Cruz Biotechnology (1 mentions)
Anti phospho met tyr1234 1235, by Cell Signaling Technology (1 mentions)
Ecl plus western blotting detection reagent, by Cytiva (1 mentions)
Cell counting kit 8 (cck8), by Dojindo Laboratories (1 mentions)
Anti phospho p44 42 mapk thr202 tyr204, by Cell Signaling Technology (1 mentions)
Facscalibur cytometer, by BD (1 mentions)
Anti phospho ampkα thr172, by Cell Signaling Technology (1 mentions)
Anti ampkα, by Cell Signaling Technology (1 mentions)
Anti lc3b, by Novus Biologicals (1 mentions)
Radioimmunoprecipitation assay buffer, by Thermo Fisher Scientific (1 mentions)
Bcl 2 2876s, by Cell Signaling Technology (1 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
Protease inhibitor cocktail, by Roche (1 mentions)
Parp 1 h 250, by Santa Cruz Biotechnology (1 mentions)
Anti β tubulin t5293, by Merck Group (1 mentions)
Lightshift chemiluminescent emsa kit, by Thermo Fisher Scientific (1 mentions)
8 protocols using anti β actin ac 15
1
Lidocaine Inhibits LPS-Induced NF-κB Activation
2
Molecular Mechanism Elucidation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot was performed using primary antibodies as follows: anti‐Met (C‐28, Santa Cruz Biotechnology), anti‐phospho‐Met (Tyr1234/1235, rabbit polyclonal antibodies, Cell Signaling Technology, Danvers, MA), anti‐phospho‐Akt (Ser473, 587F11, Cell Signaling Technology), anti‐phospho‐p44/42 MAPK (Thr202/Tyr204, rabbit polyclonal antibodies, Cell Signaling Technology), and anti‐β actin (AC‐15, Abcam, Cambridge, MA). For a secondary antibody HRP‐conjugated polyclonal anti‐rabbit IgG (Santa Cruz Biotechnology) was used. ECL Plus Western Blotting Detection Reagents (Amersham, GE Healthcare, Pittsburgh, PA) was used for color development.
DNA cell cycle analysis was performed using a detergent‐trypsin method and standard flow cytometry with a FACSCalibur cytometer (Becton Dickinson, San Jose, CA) and CELLQuest software. For the calculation of S‐phase fraction, ModFitLT 2.0 software (Verity) was used.
Cell survival after treatment with 5‐FU was evaluated using modified MTT assay with Cell Counting Kit‐8 (Dojindo Molecular Technologies, Inc., Tokyo, Japan).
DNA cell cycle analysis was performed using a detergent‐trypsin method and standard flow cytometry with a FACSCalibur cytometer (Becton Dickinson, San Jose, CA) and CELLQuest software. For the calculation of S‐phase fraction, ModFitLT 2.0 software (Verity) was used.
Cell survival after treatment with 5‐FU was evaluated using modified MTT assay with Cell Counting Kit‐8 (Dojindo Molecular Technologies, Inc., Tokyo, Japan).
3
Western Blot Analysis of Embryonic Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were extracted from whole embryos for Western blot analysis using standard protocols38 (link), 69 (link). Primary antibodies, namely anti-phospho-AMPKα (Thr172) (1:1000, Cell Signalling), anti-AMPKα (1: 1000, Cell Signalling), anti-LC3B (1:10000, Novus Biologicals), and anti-β-actin (AC-15) (1: 10000, Abcam) antibodies, were used overnight at 4 °C. Horseradish peroxidase-conjugated secondary antibodies were used for 1 h at room temperature. The signals were detected through enhanced chemiluminescence.
4
Immunoblotting Analysis of Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested in radioimmunoprecipitation assay buffer (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with a protease inhibitor cocktail (Roche Applied Science, Mannheim, Germany). The protein concentration was determined using a Pierce BCA Protein Assay kit (Thermo Fisher Scientific). Protein lysate (20 μg) was resolved in SDS-polyacrylamide gels, transferred to PVDF membrane and then probed with antibodies specific to: folate receptor alpha (FR-α) (ab125030; Abcam, Cambridge, MA, USA); Cyclin D1 (72-13G), CDK4 (C-22), and PARP-1 (H-250) (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA); p21WAF−1 (12D1) and Bcl-2 (2876S) (both from Cell Signaling Technologies, Danvers, MA, USA); and Caspase-3 (610322; BD Transduction Laboratories, San Diego, CA, USA). The membranes were next incubated with the respective secondary antibodies (Thermo Fisher Scientific). Anti-β-actin (AC-15; Abcam) and anti-β-tubulin (T5293; Sigma-Aldrich, St. Louis, MO, USA) antibodies were used as internal loading controls. The protein bands were quantitated using ImageJ software.
5
Nuclear Extract Preparation and EMSA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small-scale nuclear extracts were prepared from cells as described previously [110 (link)]. The following sequences were used to generate double-stranded oligonucleotides for EMSA: MEF-2 site from HTLV-1 LTR: 5′GAATAAACTAACAGGAG TCT3′ (biotinylated at 5′ end), MEF-2 consensus site from Glut4 promoter [111 (link)]: 5′GGGAGCTAAAAATAG CAG3′, MEF-2 consensus mutant: 5′GGGAGACG AAAA CCG CAG3′ and Oct-1: 5′TGTCGAATGCAAATCACTAGAA3′ (biotinylated at 5′ end). Nonradioactive EMSA was performed using LightShift Chemiluminescent EMSA Kit (Thermo Scientific) according to the manufacturer’s instructions. Western blotting was performed essentially as described above. Whole-cell lysates were resolved by SDS-PAGE, transferred to nitrocellulose membranes, blocked in 5% milk, incubated with the indicated primary and secondary antibodies, and detected using Western Lightning enhanced chemiluminescence reagent (Perkin Elmer). Anti-FLAG M2 was purchased from Sigma. Anti-β-actin (AC15) was from Abcam.
6
Western Blot Analysis of Cellular Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein concentrations were determined using the BCA protein assay kit (Pierce Biotechnology, Rockford, IL, USA). A total of 20 µg of cleared cell lysate was used for Western blot analysis. Antibodies used for Western blot analysis included anti-β-ACTIN (AC-15; Abcam, Cambridge, MA, USA), anti-AR (N-20; Santa Cruz Biotechnology) and anti-DDX5 (C-20; Santa Cruz Biotechnology), anti-GFP (Roche, Mississauga, ON, Canada), anti-FLAG (Sigma), and anti-SAM68 (courtesy of Dr. Stéphane Richard).30 (link)
7
Monoclonal Antibodies for Immune Cell Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The monoclonal antibodies (mAbs) for flow cytometry analysis used in this study are listed: anti-mCD11b-BV510 (Cat#: 101245; BioLegend), anti-mCD45-BUV395 (Cat#: 564279; BD), anti-mCD45-PE-Cy5 (Cat#: 103132; BioLegend), anti-mLy6G-FITC (Cat#: 127606; BioLegend),anti-mF4/80-PE-Cy5 (Cat#: 15-4801-82; Invitrogen), anti-mF4/80-PE (Cat#: 123110; BioLegend), anti-mIL-17A-PE (Cat#: 506904; BioLegend), anti-mIL-17A-BV421 (Cat#: 506925; BioLegend), anti-mIFN-γ-PE(Cat#: 505808; BioLegend), anti-mIFN-γ-FITC (Cat#: 505806; BioLegend), anti-m CD16/CD32 (2.4G2, Cat#: 553142; BD Pharmingen™). There are antibodies used for western blot assay: anti-β-Actin (AC-15; Cat#: ab6276; abcam), phospho-Stat3(Tyr705) (Cat#: 9131S; Cell signaling), phospho-Stat3 (Ser727) (Cat#: 9136S; Cell signaling), ROR gamma (t) (Cat#: 14-6988-82; eBioscience™), phospho-S6 (Ser235/236) (Cat#: 2211S; Cell signaling), phospho-eIF4E (Ser209) (Cat#: 9741S; Cell signaling), eIF4E (C46H6) (Cat#: 2067S; Cell signaling), anti-rabbit secondary antibodies (Cat#: 111-035-003; Jackson ImmunoResearch Laboratories), prestained protein ladder (Cat#: 26616; PageRuler™). Other major reagents used in this study: Recombinant murine M-CSF (Cat#: 315-02-100; PeproTec), LPS (Cat#: L2630; Sigma). All reagents were used following the manufacturers’ instructions.
8
Antibody Panel for Immunological Analyses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following antibodies were used in this study: anti-hIL-17RB (FAB1207P; R&D Systems), anti-hCD4 (555346; BD Pharmingen), anti-hCD3 (552851; BD Pharmingen), anti-hCD8 (555366; BD Pharmingen), anti-hCD25 (560989; BD Pharmingen), anti-β-actin (AC15; Abcam), anti-IκBα (SC-371; Santa Cruz Biotechnology), anti-phospho-IκBα (14D4; Cell Signaling), anti-p65 (8242S; Cell Signaling), anti-phospho-p65 (3031S; Cell Signaling), anti-IKKβ (2678; Cell Signaling), anti-phospho-IKKα/β (2697S; Cell Signaling), anti-IL-17RB (SC-52925; Santa Cruz Biotechnology), anti-TRAF6 (SC-7221; Santa Cruz Biotechnology), anti-PARP (9542S; Cell Signaling) and anti-caspase-3 (SC-7148; Santa Cruz Biotechnology).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!