Superscript 3 one step rt pcr with platinum taq kit

The Superscript III One-Step RT-PCR with Platinum Taq kit (Invitrogen) was used to prepare all samples. Each sample of RNA was prepared using 3 µg respective RNA isolate, 25 µL 2x Reaction Mix, 1 µL each of forward and reverse primers (10 µM), 2 µL Superscript III RT/Platinum Taq Mix and autoclaved distilled H₂O to a final volume of 50 µL. Two negative controls were prepared using all reagents except for RNA or enzymes. For S100B primer sequences used were (5′-3′) F: TTGCCCTCATTGATGTCTTCCA, R: TCTGCCTTGATTCTTACAGGTGAC. All samples were placed into an automated thermocycler with an initial cycle of 30 min at 55°C, followed by 2 min and then 20 sec cycles at 95°C, a 30 sec cycle at 50°C and then 90 sec cycle at 70°C. The cycles from 2 min at 95°C onward were repeated either 35 or 40 times, before a final cycle of 5 min at 70°C and cooling thereafter.

Cell pellets were resuspended using TRIzol (Invitrogen-Life Technologies, Carlsbad, CA, USA). The mRNA was extracted from subcultured HPAEC using QIAGEN’s “RNase-Free DNase Set.” RNA was put through reverse-transcription via Invitrogen’s “SuperScript III One-Step RT-PCR (with Platinum Taq) Kit.” We bought multiple human DNA primers from Invitrogen, including hTERT (SENSE–5′ ATG GGG ACA TGG AGA ACA AG 3′ and ANTISENSE–5′ GTG AAC CTG CGG AAG ACG GT 3′), β-Actin (SENSE–5′ TGA ATG GAC AGC CAT CAT GGA C 3′ and ANTISENSE–5′ TCT CAA GTC AGT GTA CAG GAA AGC 3′), FGF-2 (SENSE–5′ TCA GCT CTT AGC AGA CAT TGG AAG AAA AAG 3′ and ANTISENSE–5′ GGA GTG TGT GCT AAC CGT TAC CTG GCT ATG 3′), PRCP (SENSE–5′ ATG GGC CGC CGA GCC CTC CTG 3′ and ANTISENSE–5′ GGT TGG TTG GCA AGT GTA GG 3′), and eNOS (SENSE–5′ ATG TTT GTC TGC GGC GAT GTT AC 3′ and ANTISENSE–5′ ATG CGG CTT GTC ACT TCC TG 3′). The PCR products were visualized using 1–2% agarose gel containing ethidium bromide (agarose powder and ethidium bromide were purchased from Invitrogen and Sigma, respectively) depending on the size of the expected PCR product.

The spike gene and the ORF3 gene were amplified using a Veriti^® 96-Well Thermal Cycler (Applied Biosystems^®, Singapore) with SuperScript^® III One-step RT-PCR with Platinum^®Taq Kit (Invitrogen^™, Waltham, CA, USA) from the extracted RNA of PEDV samples. Primers for spike gene sequencing were designed according to the alignment of the spike genes of the PEDV strains collected in Vietnam in 2012–2016 from GenBank. The primers used for sequencing in this study are listed in Table 5. Briefly, 3 µL of RNA was added to a reaction mixture containing 12.5 µL of buffer, 1 µL of each specific primer (10 µM), and 1 µL of enzyme mix, and diethyl pyrocarbonate (DEPC)-treated deionized water (DW) was used to achieve a final reaction volume of 25 µL. The cycling conditions were as follows: 55 °C for 30 min, 95 °C for 2 min, followed by 40 cycles of 95 °C for 30 s, 55 °C for 30 s, 68 °C for 1 min or 40 s (S fragments or ORF3, respectively), and a final extension step at 68 °C for 10 min. Samples were stored at 4 °C. The RT-PCR products were visualized by electrophoresis on a 1% agarose gel containing RedSafe^™ Nucleic Acid Staining Solution (iNtRON, Gyeonggi-do, Korea). Correct bands were excised and purified using a QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions. All of the purified products were sequenced by Bionics Co. Ltd., Daejeon, Korea).

RNA viruses (SPCSV and SPFMV) were detected using a SuperScript III One-Step RT-PCR with Platinum Taq Kit (Invitrogen, California, United States), using the primers described by (Kwak et al., 2014 (link)). A 20 μl reaction comprising 2 μl RNA, a mixture of equal amounts of 0.5 μM forward and reverse primers and RT-PCR master mix as recommended by the manufacturer was used. Reaction conditions were: cDNA synthesis for 45 min at 52 °C; initial denaturation at 95 °C for 5 min and 40 cycles consisting of 30 s at 95 °C, 1 min at 55 °C, 1 min at 72 °C, and final extension 5 min at 72 °C. Runs were performed using a GeneAmp 9700 PCR (Applied Biosystems, Foster City, CA, USA). PCR products were analyzed by electrophoresis on a 1.5 % agarose gel, 0.5 X TE; run at 100 V for 1.30 h, stained with GelRed and visualized using a UV transilluminator. DNA virus (SPLCV–sweepoviruses) was tested by PCR as described by Li et al. (2004) (link) using Sweepovirus-specific primers SPG1 and SPG2, designed to amplify a 901-bp fragment. In addition, to assess specificity and to confirm that LAMP correctly amplified the target, RT-PCR and PCR was performed (as described above) with the F3 and B3 primers designed for LAMP (see 2.5 below) of SPFMV, SPCSV and SPLCV serving as the forward and reverse primers, respectively.