qRT-PCR were performed to analyze the transcript accumulation of LbKT1 and LbSKOR in leaves and roots. Primers used were listed in Table 1 . qRT-PCR amplifications were performed with SYBR Premix Ex Taq™ II (Perfect Real Time; Takara Biotechnology Co., Ltd, China) according to the manufacturer's instructions. The amplifications were set at 20 μL reaction system including 10 μL SYBR Premix Ex Taq™ II, 0.8 μL forward and reverse primers (10 μmol/L), 7.4 μL nuclease-free water, and 1 μL cDNA (1:10 diluted with nuclease-free water). The reactions were performed on a Bio-Rad CFX96 real-time PCR instrument and the data were analyzed by using Bio-Rad CFX Manager software, version 1.1 (Bio-Rad, USA). A melting curve was recorded at the end of each run to detect primers generating non-specific PCR products (Ririe et al., 1997 (link)). A fragment of L. barbarum actin gene was used for normalization (Hu et al., 2017 (link)). The relative expression were calculated as 2−ΔCT (ΔCT = CTgene of interest − CTactin).
Sybr premix ex taq 2 perfect
Manufactured by Takara Bio
Sourced in China, Japan, United States
SYBR® Premix Ex Taq™ II (Perfect) is a real-time PCR reagent developed by Takara Bio. It is designed to amplify and detect target DNA sequences using the SYBR® Green I dye for fluorescent detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Cfx manager software version 1, by Bio-Rad (1 mentions)
One step primescript mirna cdna synthesis kit, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Abi prism 7300 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Taqman human mirna assay kit, by Thermo Fisher Scientific (1 mentions)
Gapdh, by GeneCopoeia (1 mentions)
Quickgene rna cultured cell kit s, by Fujifilm (1 mentions)
Thermal cycler dice real time system, by Takara Bio (1 mentions)
6 protocols using sybr premix ex taq 2 perfect
1
Quantifying Transcript Levels of Key Ion Transporters in Lycium barbarum
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated via TRIzol reagent (Invitrogen, Carlsbad, CA, USA). After the concentration determined the absorbance (A)260/A280 ratio, RNA was reverse transcribed to cDNA using SuperScript reverse transcriptases (for mRNA; Thermo Fisher Scientific, Waltham, MA, USA) and the One-Step PrimeScript miRNA cDNA Synthesis Kit (for miRNA; Takara, Tokyo, Japan). qPCR for mRNA was conducted by SYBR PCR Master Mix (GenePharma, Shanghai, China) under the following conditions: 95°C for 3 min, 40 cycles of 95°C for 12 s and 62°C for 40 s. For miRNA, qPCR was performed using SYBR Premix Ex Taq II (Perfect Real Time) (Takara, Tokyo, Japan) under the following conditions: 95°C for 10 s, 40 cycles of 95°C for 5 s and 60°C for 20 s. All samples were repeated three times. The expression level of genes was calculated using the 2−ΔΔCT method. GAPDH and U6 were used as the internal control for mRNA and miRNA, respectively.
3
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIZOL (Invitrogen, Thermo Fisher Scientific, Inc.). cDNA was synthesized using 2 µg of total RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara Biotechnology Co., Ltd. Dalian, China). qRT-PCR analysis was performed using SYBR® Premix Ex Taq™ II (Perfect Real time; Takara) and under thermal cycling parameters of 95 °C for 30 sec followed by 40 cycles of 3 sec at 95 oC and 40 sec at 60 °C with the 7500 Fast Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Inc.). The primers for CD105 (forward: 5′ CGCACCGATCCAGACCACTC 3′; reverse: 5′ CCCGGCTCGATGGTGTTGGA 3′), BMP9 (forward: 5′ CTGCCCTTCTTTGTTGTCTT 3′; reverse: 5′ CCTTACACTCGTAGGCTTCATA 3′) and GAPDH (forward: 5′ CAGCGACACCCACTCCTC 3′; reverse: 5′ TGAGGTCCACCACCCTGT 3′) were constructed by TsingKe Bio-Technology Co., Ltd. (Beijing, China). Each sample was assayed in triplicate and the data were analysed using the 2-ΔΔCq method.
4
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from clinical specimens or HCC cells using TRIzol reagent (Invitrogen) following manufacturer's instruction. PCR amplification was performed using a TaqMan human miRNA assay kit (Applied Biosystems, Foster City, CA, USA) and a SYBR® Premix Ex Taq™ II (Perfect Real-Time) kit (Takara Bio Inc., Shiga, Japan) with an ABI PRISM 7300 Sequence Detection System (Applied Biosystems). qPCR primer against mature miRNA hsa-miR-519a-3p (HmiRQP0588), Homo sapiens snRNA U6 qPCR Primer (HmiRQP9001), PTEN (HQP015535) and GAPDH (HQP006940) were purchased from Genecopoeia (Guangzhou, China).
5
Quantitative RT-PCR of Gonadal Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Absolute quantitative real-time RT-PCR was used to detect the expression of genes among different development stages of gonads. The gene-specific primers used in this experiment were the same as those described above and the specificity of each pair of primers was verified via the only peak of the melt curve. The 25 μL reactive system containing 2 μL of cDNA, 0.5 μL of 10 mM each primer and 12.5 μL of SYBR® Premix Ex Taq™ II (Perfect Real Time) (Takara) and the protocol was: heat at 95 °C for 30 s, followed by 30 cycles of 95 °C for 5 s, 55 °C for 60 s for amh or 56 °C for 50 s for dax1, and a final extension step at 72 °C for 30 s. A negative control was included in each assay without cDNA and the samples were analyzed in triplicate with a Rotor-Gene Q instrument. The expression of each sample was calculated as copies/ml from the standard curve of serial dilutions.
6
Quantifying Gene Expression in Cd-treated and siRNA-transfected HK-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cd-treated or siRNA-transfected HK-2 cells were washed twice with ice-cold phosphate-based saline (PBS) (Nissui, Tokyo, Japan), and total RNA extracted with the Quick Gene RNA cultured cell kit S (Fujifilm, Tokyo, Japan) according to the manufacturer's protocol. RNA quantitation and purity were measured using the BioSpec-nano (Shimadzu Biotech, Kyoto, Japan). cDNA was generated from total RNA using the PrimeScript reverse transcription (RT) Reagent Kit (Perfect Real Time) (Takara Bio, Shiga, Japan). Real-time PCR was performed with the SYBR Premix Ex Taq II (Perfect Real Time) (Takara Bio), and a Thermal Cycler Dice Real Time System (Takara Bio). PCR conditions were as follows: 10 sec hot-start at 95°C followed by 40 cycles of 5 sec at 95°C and 30 sec at 60°C. Gene expression was normalized to GAPDH mRNA levels. The oligonucleotide sequences of the primers were as follows: sense, 5′-GCACCGTCAAGGCTGAGAAC-3′, and antisense, 5′-TGGTGAAGACGCCAGTGGA-3′, for the human GAPDH; sense, 5′-TCACTCTGGAGGTGGA-3′, and antisense, 5′-CCCTCAGGCGCAGGAC-3′, for the human UBB; sense, 5′-AAAGAGTCCACCTTGCACCTG-3′, and antisense, 5′-ACCTCAAGGGTGATGGTCTTG-3′ for the human UBC; sense, 5′-TCGTGGTGGTGCTAAGAAAA-3′, and antisense, 5′-TCTCGACGAAGGCGACTAAT-3′ for the human UBA80; sense, 5′-AGGAGGGTATCCCACCTGAC-3′, and antisense, 5′-CAGGGTGGACTCTTTCTGGA-3′ for the human UBA52.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!