Genomic DNA from the cells was extracted using the Genomic DNA Miniprep Kit (TIANGEN, DP304–02). The mtDNA copy number was measured using real-time quantitative PCR (qPCR) and was normalized to the Hbb (β-globin) gene. The primer pairs for measuring the mtDNA copy number were as follows: mtDNA forward, GCCCATGACCAACATAACTG; reverse, CCTTGACGGCTATGTTGATG; Hbb (β-globin) forward, AGGCAGAGGCAGGCAGAT; reverse, GG CGGGAGGTTTGAGACA. q-PCR reactions were performed in the LightCycler 480 II PCR System (LightCycler 480 II, Roche), using the All-in-One qPCR Mix kit (GeneCopoeia, AOPR-0200).
Genomic dna miniprep kit
Manufactured by Tiangen Biotech
The Genomic DNA Miniprep Kit is a laboratory tool designed for the rapid and efficient extraction of genomic DNA from a variety of sample types. It utilizes a simple and straightforward protocol to isolate high-quality DNA that can be used in downstream applications such as PCR, sequencing, and other molecular biology techniques.
Automatically generated - may contain errors
2 protocols using genomic dna miniprep kit
1
Quantifying Mitochondrial DNA Copy Number
2
Quantifying Cytosolic mtDNA in MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mitochondria were isolated from MSCs, Mix-MSCs, and LbL-MSCs using a mitochondrial isolation kit (Beyotime, C3601). After the mitochondria were discarded, the cytoplasm was prepared to isolate cytosolic mtDNA using a genomic DNA miniprep kit (Tiangen, DP304). Polymerase chain reaction quantification was then carried out to analyze mtDNA and nuclear DNA in the cytoplasm. mtDNA was marked by tRNA-LeuUUR, while nuclear DNA was characterized by β-microglobulin genes. The ratio of mtDNA to nuclear DNA in the cytoplasm represented the copy number of cytosolic mtDNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!