Qubit rna high sensitivity assay

RNA was extracted from 0.25 ml of VTM using 0.75 ml of TRIzol LS reagent (Invitrogen) according to the manufacturer’s protocol. RNA concentration was measured using Qubit RNA High-Sensitivity assay (Thermo Fisher Scientific) prior to use in the ARTIC v3 nCoV-2019 Sequencing protocol (Quick, 2020 ) with the exception of one sample (i.e., TR1) that required additional sequencing, for which the YouSeq v2 SARS-CoV-2 Coronavirus NGS Library preparation kit was used. In that case, the YouSeq reverse transcriptase was replaced with SuperScript IV (Thermo Fisher Scientific). Complementary DNA (cDNA) was amplified using multiplex PCR and either the associated ARTIC primer pools or YouSeq primer pools. Samples prepared via the ARTIC protocol were cleaned using 1x AMPure XP beads (Beckman Coulter) and resuspended in nuclease-free molecular grade water. Sequencing libraries were completed following the QiaSeq FX protocol (Qiagen). Libraries were checked for quality using an Agilent Bioanalyzer High-sensitivity kit (Agilent) and quantitated using the Qubit DNA High-Sensitivity assay (Thermo Fisher Scientific) prior to sequencing using Illumina MiSeq v3 2×300 chemistry (Illumina).

Viral genome sequencing and analysis was conducted from primary material at Naval Medical Research Center, Fort Detrick, MD, under non-human subject research determination PJT 20-08. Briefly, RNA was extracted from 0.25 mL of VTM using 0.75 mL of TRIzol LS reagent (Invitrogen; Carlsbad, CA, USA) according to the manufacturer’s protocol. The RNA concentration was measured using a Qubit RNA High Sensitivity assay (ThermoFisher Scientific; Waltham, MA, USA) prior to use in the ARTIC nCoV-2019 sequencing protocol [31 (link)], the NEBNext ARTIC SARS-CoV-2 Library Prep Kit (New England Biolabs, Ipswich, MA, USA), and/or the QIAseq DIRECT SARS-CoV-2 Kit (Qiagen, Valencia, CA, USA). Briefly, the RNA was reverse-transcribed, and cDNA was then amplified using multiplex PCR and either the associated ARTIC primer pools or the QIAseq DIRECT primer pools. The inserts were then polished and ligated to Illumina-compatible adaptors and indexes. The libraries were quality-checked using an Agilent High Sensitivity DNA kit (Agilent Technologies; Santa Clara, CA) and quantitated using a Qubit DNA High Sensitivity assay (ThermoFisher Scientific) prior to sequencing using Illumina MiSeq v3 2 × 300 sequencing kits and MiSeq sequencers (Illumina; San Diego, CA, USA).

Synthesis of dpCoA-RNA was mainly performed as described previously [18 (link)]. Transcription was conducted in the presence of 2 mM dpCoA (Cayman Chemical, Ann Arbor, MI, USA), 1 mM ATP, 2 mM CTP, 2mM UTP, 2mM GTP, 40 mM Tris-HCl pH 8.0, 22 mM MgCl₂, 1 mM spermidine, 0.01% Triton-X-100, 5% dimethyl sulfoxide (DMSO), 10 mM dithiothreitol (DTT), 12.5 ng/µL template, and 250 ng/µL T7 RNA polymerase at 37 °C for 4 h. An amount of 1.25 µM α-³²P-CTP (3000 Ci/mmol, Hartmann Analytics, Braunschweig, Germany) was included, if visualization using ³²P-imaging was desired. The 107 nucleotide (nt)-long E. coli RNAI sequence with ϕ2.5 T7 promoter was chosen as a double-stranded DNA template (Integrated DNA Technologies, Coralville, IA, USA) desalted).
RNA sequence (5′-3′):
ACAGUAUUUGGUAUCUGCGCUCUGCUGAAGCCAGUUACCUUCGGAAAAAGAGUUGGUAGCUCUUGAUCCGGCAAACAAACCACCGCUGGUAGCGGUGGUUUUUUUGU
Transcription products were purified using 10% PAGE followed by 10% APM-PAGE. The concentration was determined using the Qubit RNA high sensitivity assay on a Qubit 2.0 fluorometer (both ThermoFisher Scientific).