Scrambled oligonucleotide

For transfection studies, HLECs were plated at 50,000 cells per well 24 hours before transfection. Lipofectamine™ 2000 transfection reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) were used to transfect plasmid, siRNA, miR-27a mimic, or miR-27a inhibitor, according to the manufacturer’s instructions. Expression plasmids for Smad4, namely pRK5-FLAG-Smad4, were kindly provided by Dr. Bert Vogelstein. Scrambled oligonucleotide (Genepharm, Shanghai, China), Smad4 siRNA (Genepharm, Shanghai, China), miR-27a mimic (Genepharm, Shanghai, China) and miR-27a inhibitor (Genepharm, Shanghai, China) were transfected into HLECs at the indicated concentrations.

For lncRNA CTBP1-DT or ETV5 overexpression, the full-length lncRNA CTBP1-DT or ETV5 cDNA was amplified and subcloned into pcDNA3.1. An empty vector was used as a negative control. The putative lncRNA CTBP1-DT promoter regions (−2000/0, −1200/0 and −300/0) were PCR-amplified from the genomic DNA and then inserted into the HindIII-NheI sites upstream of the firefly luciferase in the pGL3-Basic vector (Promega, Madison, WI, USA). All constructs were named based on the location of the promoter fragments relative to the transcription start site (TSS). MAP3K3 and sh-MAP3K3 plasmids were provided by Dr Yang (Baylor College of Medicine, USA). All plasmids were isolated using an E.N.Z.A Eno-free Plasmid DNA Mini Kit II (OMEGA, D6950-01, USA). An hsa-miR-188-5p mimic was used instead of miR-188-5p, a chemically modified antisense oligonucleotide (antagomir AMO-101) was used to inhibit miR-188-5p expression and a scrambled oligonucleotide (GenePharma) was used as a control. Cells were seeded in 6-well plates and cultured to 60–70% confluence before transfection. Lipofectamine^® 2000 reagent (Life Technologies, USA) was used as the transfection medium according to the manufacturer’s protocol.

The synthetic mimics of miR-424 and miR-27a along with scrambled oligonucleotides were purchased from GenePharma (Shanghai, GenePharma Co.Ltd). SiRNAs of PLAG1 and its negative control were synthesized by Ribobio (Guangzhou Ribo Bio Co. Ltd). Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) was used to transfect cells with miRNAs or siRNAs at a final concentration of 50 nM according to the manufacturer's instructions.

UBE2T was disrupted by small interfering RNA, siUBE2T. siUBE2T oligonucleotides and corresponding scrambled oligonucleotides were purchased from Genepharma (Shanghai, China). Their sequences were as follows: siUBE2T: GCUGACAUAUCCUCAGAAUTT; Scrambled: UUCUCCGAACGUGUCACGUTT. Briefly, CNE2 cells were cultured under complete medium conditions in a 6-well plate, transiently transfected with siUBE2T oligonucleotides and scrambled with 5 μl iMAX (Invitrogen, Carlsbad, CA, USA). After 48 hours, the cells were harvested for western blotting to determine the interfering efficiency.

The synthetic mimics of miR-302a along with scrambled oligonucleotides were purchased from Genepharma (Shanghai, China). SiRNAs of Rad52 and its negative control were synthesized by Genscript (Nanjing, China). Lipofectamine 2000 reagent (Invitrogen) was used to transfect cells with miRNAs or siRNAs at a final concentration of 50 nM according to the manufacturer’s protocol.
And the sequences of miRNA and siRNA were as follows:

NC: AGGUAGUGUAAUCGCCUUG;

siRad52-1: UGAGAUGUUUGGUUACAAU;

siRad52-2: CCCUGAAGACAACCUUGAA;

miR-NC: UUGUACUACACAAAAGUACUG

miR-302a mimic: UAAGUGCUUCCAUGUUUUGGUGA.