Sybr green 2 step qrt pcr kit

A kit from Qiagen (RNeasy™ Plus Mini Kit) was used for RNA isolation from cell cultures, and RNA quality was tested by measuring the ratio 260/280 nm in a UV-spectrophotometer. Real-time qRT-PCR analysis was optimized by SYBR Green 2-step qRT-PCR kit protocol (DyNAmo™, Finnzymes, Finland). Specific primers were as follows, respectively: IL-4, sense: ATGGGTCTCAACCCCCAGCTA-3, antisense: TGCATGGCGTCCCTTCTCCT;  IL-5, sense: TGAAGGCCAGCGCTGAAGAC, antisense: GCGGACAGCTGTGTCAAGGTC; IL-13, sense: ATGAGTCTGCAGTATCCCG, antisense: CCGTGGCAGACAGGAGTGTT; IFN-γ, sense: AGCCAAGCGGCTGACTGAACT, antisense: TAAAGCGCTGGCCCGGAGT; IL-17A, sense: TCACCCTGGACTCTCCACCG, antisense: GTCCAGCTTTCCCTCCGCAT; IL-10, sense: GGCCCTTTGCTATGGTGTCCT, antisense: GTAGGGGAACCCTCTGAGCTGC; TGF-β1, sense: CCTGAGTGGCTGTCTTTTGA, antisense: CGTGGAGTTTGTTATCTTTGCTG; GAPDH, sense: CATGGCCTTCCGTGTTC, antisense: CCTGGTCCTCAGTGTAGC. The PCR was started at 95°C for 10 minutes (hot start) to activate the AmpliTaq polymerase, followed by 40 cycles of amplification (denaturation at 95°C for 15 seconds, annealing at 60°C for 1 min, extension at 72°C for 60 seconds, and plate reading at 60°C for 10 seconds). The temperature of PCR products was elevated from 65°C to 95°C at a rate of 0.2°C/1 sec, and the resulting data were analyzed by using the software provided by the manufacturer (Applied Biosystems Inc., Foster City, USA).