The largest database of trusted experimental protocols
Sourced in China, United States

The DU145 is a cell line derived from human prostate cancer. It is a commonly used model system in cancer research and drug development studies. The DU145 cell line provides a standardized and well-characterized in vitro platform for investigating various aspects of prostate cancer biology.

Automatically generated - may contain errors

103 protocols using du145

1

Profiling Cell Lines for Prostate Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human normal embryonic kidney cell line HEK293T, human normal prostate epithelial cell line RWPE1, and PCa cell lines (PC-3, DU145, LNCAP, VCAP, and 22RV1) were purchased from the National Collection of Authenticated Cell Cultures (Shanghai, China). HEK293T and VCAP cells were cultured in Dulbecco's modified Eagle medium (Gibco), RWPE-1 cells in keratinocyte serum-free medium (Gibco), and PC-3, DU145, LNCAP, and 22RV1 cells in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco). Fetal bovine serum (10%, Gibco), 100 U/ml penicillin, and 100 μg/ml streptomycin (Invitrogen) were supplementary to the above medium. The cells were cultured at 37°C in a humidified incubator with 95% air and 5% CO222 (link).
+ Open protocol
+ Expand
2

Prostate Cancer Cell Lines Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human prostate cancer cell lines, PC3, DU145, and LNCaP Clone FGC, were obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China) and were STR certified. PCR was used to detect Mycoplasma in the culture medium, and the passage time of the cells was not more than 6 months. The cell lines were cultured in RPMI 1640 (HyClone, USA) supplemented with 10% fetal bovine serum (FBS, Gibco) and grown at 37 °C, 5% CO2. The antibodies included TACR2 (Proteintech, 25270-1-AP), beta-Catenin (Proteintech, 51067-2-AP), GAPDH (Cell Signaling Technology, 5174S), Cyclin D1 (Cell Signaling Technology, 55506S), Lamin B1 (Cell Signaling Technology, 13435S).
+ Open protocol
+ Expand
3

Prostate Cancer Cell Migration and Invasion

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prostate cancer cell lines (PC3 and DU145) were obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China) and identified by STR. PC3 and DU145 were maintained in 1640 medium and Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). The cells were cultured in a humidified incubator with 5% CO2 at 37°C.
The migration or invasion capacity of the cells was measured using a transwell insert containing polycarbonate filters with 8-μm pores. For invasion assay, the upper chamber surface was coated with 50 μL of 1 mg/mL matrigel matrix (Corning, 356,234).
+ Open protocol
+ Expand
4

Culturing and Treating PCa Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
All PCa cell lines, including 22Rv1, DU145, C4–2, PC-3, and LNCaP, were obtained from the National Collection of Authenticated Cell Cultures. DU145 and PC-3 were cultured in Dulbecco’s modified Eagle’s medium, and 22Rv1, C4–2, and LNCaP were cultivated in RPMI-1640 medium. Culture media contained 10% fetal bovine serum and 1% double antibiotics (Penicillin and Streptomycin). All cell lines were maintained at 37 °C and 5% CO2. For treatment with EBSS (24010043, GIBCO), 22Rv1 and DU145 were maintained in EBSS with or without 50 nM CQ (C6628-25G, 10 Sigma) or 10 μM BafA1 (B1793, Sigma) for 6 h.
+ Open protocol
+ Expand
5

Prostate Cancer Cell Line Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prostate cancer cells 22RV1, DU145, and PC3 and the normal prostate epithelial cells RWPE‐1 in our study were obtained from the National Collection of Authenticated Cell Cultures, Shanghai, China. The cells were incubated in the corresponding medium supplemented with 10% heat‐inactivated fetal bovine serum (PAN, Germany) in a humid environment containing 5% CO2 at 37℃.
+ Open protocol
+ Expand
6

Authenticated Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
SW480 and SW620 (Human colon cancer cell lines), CT26 (Mouse colorectal cancer cell line), HepG2 (Human liver cancer cell line), Du145 (Human prostate cancer cell line), A549 (Human lung cancer cell line) and MCF-7 (Human breast cancer cell line) were purchased from National Collection of Authenticated Cell Cultures (Shanghai, China).293T were purchased from the American Type Culture Collection (ATCC). All cell lines were received as early passages and cultured in DMEM or RPMI-1640 supplemented with 10% fetal bovine serum (FBS) (Biological Industries, Israel). Cells were maintained at 37 °C in humidified atmosphere containing 5% CO2. The medium was changed every other day, cells were passaged using 0.25% trypsin (Solarbio, China) and preserved at early passages. All cell lines were free of mycoplasma contamination.
+ Open protocol
+ Expand
7

Cell Cycle Synchronization Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
DU145, PC3, BT549 and HEK293T cells were purchased from the National Collection of Authenticated Cell Cultures. Human dermal fibroblast (HDF) cells were gifted by Center for Molecular Medicine of Xiangya Hospital, Central South University. These cells were maintained in DMEM or 1640 medium supplemented with 10% fetal bovine serum (FBS), 1% penicillin and streptomycin. For synchronization in G1/S phase, cells were treated with 2 mM thymidine (Sigma-Aldrich, Shanghai) for 18 h, and then washed and cultured in fresh medium for 9 h. The 18 h thymidine treatment was repeated once. For synchronization in S phase, DU145 cells first were synchronized at G1/S phase using a double treatment of thymidine, and then were washed and cultured in fresh medium for 3 h. For synchronization in mitotic phase, DU145 cells were treated with nocodazole (50 ng/ml) (Chemicals Selleck, Selleck, Shanghai) for 16 h.
+ Open protocol
+ Expand
8

NF and CAF Conditioned Media Effects on Prostate Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
One million NFs and CAFs were seeded into 10 cm culture dishes and cultured in 10 ml of serum-free medium for 2 days. Supernatant was then collected. PCa cell lines PC-3 and DU145 were purchased from the National Collection of Authenticated Cell Cultures (Shanghai, China). PC-3 cells were cultured in RPMI-1640 medium (Gibco, USA) and DU145 in DMEM medium (C11995500BT, Gibco). Cell culture medium was supplemented with 10% FBS (ExCell Bio, China) and 1% penicillin/streptomycin (C100C5, NCM Biotech, China). All cells were mycoplasma free and cultured at 37 °C in a humidified 5% CO2 atmosphere. Supernatant from NF and CAF medium was added into plates where PC-3 and DU145 cells were incubated, and a final supernatant concentration was 50%.
+ Open protocol
+ Expand
9

Silencing FTO in Prostate Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human prostate cancer cell lines, DU145 and PC3, were purchased from the National Collection of Authenticated Cell Cultures (Shanghai, China). DU145 and PC3 were cultured in RPMI 1640 with 10% serum and incubated at 37°C, 5% CO2. The two Small interfering RNAs (JTSBIO) sequences used to reduce FTO expression sequences used to reduce FTO expression were as follows: GCAGUGUAUCUGAGGAGCUCCAUAA UUAUGGAGCUCCUCAGAUACACUGC; CAGGCUGCACCUACAAGUACCUGAA UUCAGGUACUUGUAGGUGCAGCCUG.
+ Open protocol
+ Expand
10

Establishing Paclitaxel-Resistant Prostate Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two PCa cell lines (PC3 and DU145) and RWPE-1 normal human prostate epithelial cells were purchased from the National Collection of Authenticated Cell Cultures (Shanghai, China). All cells were cultured in Roswell Park Memorial Institute 1640 (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (Gibco) and maintained in a humidified atmosphere containing 5% CO2 at 37°C. PR PCa cell lines (PC3-PR and DU145-PR) were established according to a previous report.27 (link) Then PC3-PR and DU145-PR cells were cultured in normal medium with 10 nmol l−1 paclitaxel (Selleck, Houston, TX, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!