Src inhibitor pp2

Manufactured by Merck Group

Sourced in Germany, United States

Src inhibitor PP2 is a potent and selective inhibitor of the Src family of non-receptor tyrosine kinases. It is a useful tool compound for in vitro studies of Src kinase activity and signaling pathways.

Automatically generated - may contain errors

Lab products found in correlation

β actin 13e5, by Cell Signaling Technology (1 mentions) Mg101, by Bio-Techne (1 mentions) Anti mouse and rabbit horseradish peroxidase conjugated secondary antibodies, by Merck Group (1 mentions) Lamp1 clone h4a3, by Developmental Studies Hybridoma Bank (1 mentions) Chlorpromazine, by Merck Group (1 mentions) Cf680r maleimide, by Biotium (1 mentions) Rock inhibitor y 27632, by Merck Group (1 mentions) Hrp conjugated secondary antibody, by Thermo Fisher Scientific (1 mentions) Anti goat igg, by R&D Systems (1 mentions) Anti mouse igg, by R&D Systems (1 mentions) Alexafluor 488 594 conjugated secondary antibody, by Thermo Fisher Scientific (1 mentions) P smad2, by Cell Signaling Technology (1 mentions) P smad3, by Cell Signaling Technology (1 mentions) 4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions) Gsk3β, by Cell Signaling Technology (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) β catenin, by Cell Signaling Technology (1 mentions) Protein a g agarose bead, by Santa Cruz Biotechnology (1 mentions) Tgf β, by R&D Systems (1 mentions) U 73122, by Thermo Fisher Scientific (1 mentions)

8 protocols using src inhibitor pp2

Quantifying Phosphorylated p38 MAPK

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rabbit phospho-p38 MAPK (Thr180/Tyr182) (D3F9) XP™ (#4511) and β-Actin (13E5) antibodies were from Cell Signaling Technology, Frankfurt am Main, Germany. HIF-1α clone H1α67, HIF-1α clone EP1215Y, anti-mouse and -rabbit horseradish peroxidase-conjugated secondary antibodies were from Merck Millipore, Darmstadt, Germany. Src-Inhibitor PP2 was purchased from Sigma-Aldrich (#P0042), Darmstadt, Germany. p38 MAPK inhibitor (SB203580), MG132 and MG101 were from Tocris, Wiesbaden-Nordenstadt, Germany. Bortezomib and Epoxomicin were from Calbiochem. All other chemicals were from Sigma-Aldrich, Darmstadt, Germany.

Heun Y., Grundler Groterhorst K., Pogoda K., Kraemer B.F., Pfeifer A., Pohl U, & Mannell H. (2019). The Phosphatase SHP-2 Activates HIF-1α in Wounds In Vivo by Inhibition of 26S Proteasome Activity. International Journal of Molecular Sciences, 20(18), 4404.

+ Open protocol

+ Expand

Antibody Optimization for β-Catenin and LAMP1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used in this study: mouse mAb anti β-catenin (BD TL 610154, Lot #9315374, IF 1:600), mouse mAb anti LAMP1 clone H4A3 (Developmental Studies Hybridoma Bank, IF 1:600). Reagents: recombinant human vitronectin (VN, Peprotech 140-09), fibronectin (FN, isolated from human plasma, SA #F2006), rat tail type I collagen (Advanced BioMatrix #5153), methylcellulose (Sigma-Aldrich #M7027), poly(2-hydroxyethyl methacrylate (polyHEMA, Sigma-Aldrich #P3932); Src inhibitor PP2 (Sigma-Aldrich #529573); MEK1/2 inhibitor CI-1040 (Atriva Therapeutics GmbH, Tübingen, Germany, kindly provided by Dr. A. Schreiber, Institute of Molecular Virology, ZMBE, Münster).

Schwietzer M.F., Thölmann S., Kummer D., Kaschler A., Greune L., Thüring E.M., Schmidt M.A., Gerke V, & Ebnet K. (2022). Loss of contact inhibition of locomotion in the absence of JAM-A promotes entotic cell engulfment. iScience, 25(10), 105144.

+ Open protocol

+ Expand

Integrin and Clathrin-Mediated Endocytosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-integrin-β3 monoclonal antibody (LIBS2) was purchased from EMD Millipore (Billerica, MA, USA). Anti-integrin-β1 monoclonal antibody (#550531) and Anti-Clathrin heavy chain monoclonal antibody (#610499) were purchased from BD Biosciences (San Jose, CA, USA). Anti-Dab2 monoclonal antibody (D709T) was purchased from Cell Signaling (Boston, MA, USA). Anti-Numb polyclonal antibody (#ab14140) was purchased from Abcam. For fixed cell experiments, cells were fixed with 4% flesh-prepared paraformaldehyde, permeabilized with 0.05% Triton X and blocked with 5% casein or BSA overnight. Primary antibodies were used in 1:200 dilution, followed by secondary antibodies in 1:1,000 dilution. Micro-ruby dextran (3 kD, with both tetramethylrhodamine and biotin) with a biotin tag was purchased from Life Technologies. CF680R maleimide and phalloidin labelled with CF405 or CF680R dye were purchased from Biotium (Hayward, CA, USA). ROCK inhibitor Y27632, Src inhibitor PP2 and chlorpromazine were purchased from Sigma-Aldrich (St Louis, MO, USA). Chemicals were first kept as a stock concentration 1,000 times higher than the final concentration. Before applying to cells, chemicals were diluted 1,000 times into DMEM media.

Yu C.H., Rafiq N.B., Cao F., Zhou Y., Krishnasamy A., Biswas K.H., Ravasio A., Chen Z., Wang Y.H., Kawauchi K., Jones G.E, & Sheetz M.P. (2015). Integrin-beta3 clusters recruit clathrin-mediated endocytic machinery in the absence of traction force. Nature Communications, 6, 8672.

+ Open protocol

+ Expand

Integrin Modulation and Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells were treated with 10 nM of NZ for 30 min and 0.5 μg ml⁻¹ of Cyto D for 1 h at 37 °C. For integrin blocking experiments, the P4C10 antibody (antibody supernatant from Hybridoma Bank, 1:100 dilution) was added to the cells for 30 min at 37 °C before fixation. For integrin overactivation experiments, cells were treated with 10 μg ml⁻¹ or 50 μg ml⁻¹ of RGD peptide for 1 h, or with 0.625 μg ml⁻¹ 9EG7 antibody for 1 h or with 10 μg ml⁻¹ of RGD for 30 min followed by treatment with 10 μg ml⁻¹ of RGD and 0.625 μg ml⁻¹ 9EG7 for another 30 min at 37 °C. Xenopus embryos were treated with 8 μΜ of Src inhibitor PP2 (Sigma) from stage 9 until they were fixed at stage 15.

Petridou N.I, & Skourides P.A. (2016). A ligand-independent integrin β1 mechanosensory complex guides spindle orientation. Nature Communications, 7, 10899.

+ Open protocol

+ Expand

Signaling Pathway Analysis in EMT

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies against IL-15 [monoclonal antibody (mAb) L-20], antibodies against N-cadherin, vimentin, and zona occludens 1 (ZO-1), protein A/G–agarose beads, control small interfering RNA (siRNA; sc-37007), and FAK-siRNA (sc-29310) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Primary antibodies against E-cadherin, p-Src, Src, p-Akt, Akt, p-Erk1/2, Erk1/2, p-FAK, FAK, p-PI3K, PI3K, p-glycogen synthase kinase-3β (GSK-3β), GSK-3β, β-catenin, p-Smad2, Smad2, p-Smad3, and Smad3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibodies were purchased from Cell Signaling Technology (Beverly, MA). Anti–IL-15–phycoerythrin (mAb247-PE), anti-mouse IgG, anti-goat IgG, rhIL-15 Rα/Fc chimera soluble (s-IL-15Rα) chain, and transforming growth factor–β (TGF-β) were purchased from R&D Systems (Minneapolis, MN). Src inhibitor PP2, Akt inhibitor MK2206, and Erk inhibitor PD98059 were purchased from Sigma-Aldrich (St Louis, MO). HRP-conjugated secondary antibody, Alexa Fluor 488/594–conjugated secondary antibody, 4',6-diamidino-2-phenylindole (DAPI), and Lipofectamine 2000 were purchased from Invitrogen (Carlsbad, CA). All other chemicals were obtained from Sigma-Aldrich.

Yuan H., Meng X., Guo W., Cai P., Li W., Li Q., Wang W., Sun Y., Xu Q, & Gu Y. (2015). Transmembrane-Bound IL-15–Promoted Epithelial-Mesenchymal Transition in Renal Cancer Cells Requires the Src-Dependent Akt/GSK-3β/β-Catenin Pathway. Neoplasia (New York, N.Y.), 17(5), 410-420.

+ Open protocol

+ Expand

Adhesion Molecule Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pretreatments for flow chamber and VCAM-1 binding assays included kinase inhibitors and blocking antibodies. The cells were diluted to 1*10^6/ml in RPMI1640 (PAN Biotech) + 10% FCS (Sigma) + 1% PS (PAN Biotech) and incubated for 30 min at 37°C with SRC inhibitor pp2 or the respective control pp3 (both Sigma; final concentration 20 µM), the Plcγ inhibitor U73122 or the respective control U73433 (both Thermo; final concentration 5 µM) or the FAK1 inhibitor FAK14 (Invitrogen, final concentration 5 µM), Natalizumab/anti-VLA-4 (Tysabri; final concentration 10 µg/ml) or anti VLA-2 (Millipore; final concentration 10 µg/ml). MCAM blocking was performed using anti MCAM (clone2107, Prothena; final concentration 10 µg/ml).

Zondler L., Herich S., Kotte P., Körner K., Schneider-Hohendorf T., Wiendl H., Schwab N, & Zarbock A. (2020). MCAM/CD146 Signaling via PLCγ1 Leads to Activation of β1-Integrins in Memory T-Cells Resulting in Increased Brain Infiltration. Frontiers in Immunology, 11, 599936.

+ Open protocol

+ Expand

Src Signaling Regulates VE-Cadherin in HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

HUVECs were obtained from Sciencell. The sequences of oligonucleotide for c-Src and control siRNA were synthesized by GenePharma (Shanghai, China). The siRNA-targeted sequences were as follows: control siRNA, AATTCTCCGAACGTGTCACGT; Src siRNA, TGTTCGGAGGCTTCAACTCCT. The Src overexpressing plasmid (pcDNA3/flag-Src) and the mutants at Lys298 (kinase deficiency flag-Src-K298M, K298M) and at Tyr530 (constitutive active flag-Src-Y530F, Y530F) were synthesized by Genechem company (Shanghai, China). Antibody against Src (#2108, CST, MA, USA), p-SrcY416 (#2101, CST, MA, USA), p-moesin Thr558 (sc-12895, Santa, CA, USA), moesin (sc-136268, Santa CA, USA), p-VE-cadherin Y658 (ab27775, abcam, MA, USA), VE-cadherin (ab33168, abcam, MA, USA), p-FAK Y925(#3284, CST, MA, USA), and FAK(#3285, CST, MA, USA) were used. Src inhibitor PP2 (Cat# 529573) was acquired from Merck (Darmstadt, Germany); FAK inhibitor PF573228 (PZ0117) was purchased from Sigma (Shanghai, China).

Zhang W., Xu Q., Wu J., Zhou X., Weng J., Xu J., Wang W., Huang Q, & Guo X. (2015). Role of Src in Vascular Hyperpermeability Induced by Advanced Glycation End Products. Scientific Reports, 5, 14090.

+ Open protocol

+ Expand

Cell Culture Reagents and Neutrophil Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cell culture reagents unless specified elsewhere, were from Life Technologies, (Carlsbad, CA, USA). All chemicals not specified are from Sigma-Aldrich (St. Louis, MO, USA). Human neutrophil elastase (NE) was from Athens Research & Technology (Athens, GA, USA). Collagen Type I from rat tail and Src inhibitor PP2 were obtained from EMD Millipore (Burlington, MA, USA). Human recombinant G M-CSF and M-CSF were from Peprotech (Rocky Hill, NJ, USA). pHrodo Red E. coli BioParticles Conjugate for phagocytosis was from Thermo Fisher Scientific.

Krotova K., Khodayari N., Oshins R., Aslanidi G, & Brantly M.L. (2020). Neutrophil elastase promotes macrophage cell adhesion and cytokine production through the integrin-Src kinases pathway. Scientific Reports, 10, 15874.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!