Image station 440

Following the dissection of the basal forebrain, tissues were homogenized in buffer RLT (Qiagen) and frozen at −70°C. Total RNA was extracted from homogenized samples using an RNAeasy kit (Qiagen) according to manufacturer’s instructions. RNAs were used for reverse transcriptase PCR using Superscript™ One-Step RT-PCR with Platinum® Taq (Invitrogen Life Technologies). First strand cDNA synthesis was performed using the extracted total RNA (10 ng for β-actin, 25 ng for Chat, and 50 ng of RNA for Bmp9), oligo dT primer and reverse transcriptase at 48°C (45 min). Primers used for PCR include β-actin (Forward: CACAGCTGAGAGGGAAATC, Reverse: TCAGCAATGCCTGGGTAC), Chat (Forward: CGGGATCCTGCCTCATCTCTGGTGT, Reverse: GGCGGAATTCAATCACAACAT), and Bmp9 (Forward: TAAACCTCAGCGGCATTCC, Reverse: AAACGACCATGCTTCCTTCC). PCR was performed using Platinum Taq DNA polymerase with a denaturing step for 2 min at 94°C, followed by 32–40 cycles of 1 min at 94°C, 1 min at 58°C and 2 min at 72°C (32 cycles for β-actin, 36 for Chat, and 40 for Bmp9) and terminated by an elongation step at 72°C for 7 min. PCR products were displayed on a 10% polyacrylamide gel and stained with ethidium bromide. PCR products were visualized with Kodak Image Station 440 and product intensities were quantified using Kodak software.

The detection of the desired point mutations in the established Ba/F3 cell lines and the sequence of primers used for mutagenesis and sequencing were obtained using Vector NTI (Life Technologies). Chromatograms were visualized using Chromas 2 (Technelysium, South Brisbane Queensland, Australia).
Western blot bands were visualized using Image Station 440 (Kodak, Rochester, NY), and protein expression levels were quantified using Carestream MI SE (Carestream Health, Inc., Rochester, NY).
Dose–response curves were analyzed using Graph-Pad Prism4 (GraphPad Software, Inc., La Jolla, CA). The IC₅₀ value indicates the concentration of inhibitor that gives half maximal inhibition. Relative resistance (RR) index was calculated as the ratio between mutant and WT IC₅₀ values. RR values were categorized in four resistance levels: sensitive (RR ≤ 2), moderately resistant (2 < RR ≤ 4), resistant (4 < RR ≤ 10), or highly resistant (RR > 10) 26 (link).

Cells were lysed with cell lysis buffer (cell signaling) in the presence of protease inhibitor cocktail (complete, Roche) and 1 mM phenylmethylsulfonyl fluoride (PMSF) (Santa Cruz Biotechnologies). Cell lysates were subjected to 10% SDS-PAGE, transferred to PVDF membranes (Bio-Rad) and were treated with primary and secondary antibodies, respectively. The blots were visualized using the protoglow ECL (National Diagnostics) and image station 440 (Kodak). Antibodies used were as follows: anti- IκBα (44D4; Cell Signaling), anti-phospho- IκBα (5A5; Cell Signaling), anti-actin (I-19; Santa Cruz Biotechnologies), HRP-conjugated anti-mouse IgG (Cell Signaling), HRP-conjugated anti-rabbit IgG (Cell Signaling), and HRP-conjugated anti-goat IgG (Santa Cruz Biotechnologies).

Colonic specimens were dissected to separate the mucosal/submucosal layer from underlying neuromuscular tissues. Samples of colonic muscular tissue or ICSMCs were homogenized in RIPA lysis buffer (Cole Parmer homogenizer, Generalcontrol SpA, Milano, Italy). Homogenates were spun by centrifugation at 20,000 × g for 15 min. at 4°C. Supernatants were then separated from pellets and stored at −80°C. Protein concentration was determined by the Bradford method (Protein Assay Kit; Bio-Rad, Hercules, CA, USA). Equivalent amounts of protein lysates (50 μg for tissues and 10 μg for ICSMCs) were separated by 8% SDS-PAGE for immunoblotting. After transfer onto a PVDF membrane, the blots were blocked and incubated overnight with a rabbit anti-collagen I antibody (Ab34710; Abcam, Cambridge, UK) or a goat anti-transmembrane 16A/Anoctamin1 (TMEM16A/ANO1) antibody (Table1). After repeated washings with TBS-T, appropriate secondary peroxidase-conjugated antibodies (Santa Cruz Biotech, Santa Cruz, CA, USA) were added for 1 hr at room temperature. Immunoreactive bands were then visualized by incubation with chemiluminescent reagents (Immobilon reagent; Millipore, Billerica, MA, USA), and examined by Kodak Image Station 440 for signal detection. To ensure equal sample loading, blots were stripped and reprobed for determination of β-actin by a specific antibody (P5747; Sigma-Aldrich, Milan, Italy).