Reverse transcription kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, China, Germany, Lithuania, Japan, Canada, United Kingdom, Switzerland, France

The Reverse Transcription Kit is a reagent system designed for the conversion of RNA into complementary DNA (cDNA) through the process of reverse transcription. The kit provides the necessary components, including an RNA-dependent DNA polymerase (reverse transcriptase), random primers, and buffer solutions, to facilitate the efficient synthesis of cDNA from RNA samples.

Automatically generated - may contain errors

Lab products found in correlation

1 270 protocols using reverse transcription kit

Quantifying Gene Expression in Hippocampus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR (qPCR) was performed in hippocampus samples collected immediately after context fear test of FC procedure, as previously described (Moreira-Rodrigues et al., 2007 (link); Mendes et al., 2018 (link)). Total RNA isolation was carried out with the SV Total RNA Isolation System kit (Promega, Fitchburg, WI, USA). Concentration and purity of the isolated RNA were measured using the NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Reverse transcription was performed in a T100™ Thermal Cycler (Bio-Rad, Hercules, CA, USA) using a Reverse Transcription kit (Thermo Scientific, Waltham, MA, USA). qPCR reactions were carried out in StepOne™ RT-PCR System (Applied BioSystems, Waltham, MA, USA). Gene-specific primers (5 μM), Maxima SYBR Green qPCR Master Mix (Thermo Scientific, Waltham, MA, USA), Nuclease-free H₂O (Thermo Scientific, Waltham, MA, USA) were mixed and cDNA was added (1:20). Instead of cDNA, Nuclease-free water (Thermo Scientific, Waltham, MA, USA) was added as a negative control. Gene specific primers are in Table 1. Results of mRNA quantification are expressed in an arbitrary unit (AU) after normalization for Glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

Oliveira A., Martinho R., Serrão P, & Moreira-Rodrigues M. (2018). Epinephrine Released During Traumatic Events May Strengthen Contextual Fear Memory Through Increased Hippocampus mRNA Expression of Nr4a Transcription Factors. Frontiers in Molecular Neuroscience, 11, 334.

+ Open protocol

+ Expand

Quantitative PCR Analysis of HDAC3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 15 female hearts of each genotype with TRIzol reagent (Ambion #15596018). The samples were treated with DNase I (Qiagen) to remove DNA. Reverse transcription was performed using the reverse transcription kit (Thermo Fisher Scientific, #k1622) according to the manufacturer’s instructions. SYBR Green (Bimake, #B21202) was used as fluorescent dye for qPCR reaction. Thermal cycling and fluorescence monitoring were performed in StepOne Plus Real-Time PCR instrument (Applied Biosystems). The primers used are listed below.
Primers:
HDAC3-F: 5′TGAACTACGGACTGCACAAGAA3′
HDAC3-R: 5′CTTCGTATAGGCCACGGAATTG3′

Okuda S., Nakamura T., Yamamoto T., Ruoslahti E, & Border W.A. (1991). Dietary protein restriction rapidly reduces transforming growth factor beta 1 expression in experimental glomerulonephritis.. Proceedings of the National Academy of Sciences of the United States of America, 88(21), 9765-9769.

+ Open protocol

+ Expand

Quantitative real-time PCR protocol for gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from lung tissues and cells using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). RNA was reverse-transcribed into cDNA using a reverse transcription kit (Thermo Fisher Scientific). Quantitative real-time PCR (Q-PCR) was performed. The Q-PCR conditions were: 95 °C for 2 min, followed by 40 cycles of 95 °C for 3 s and 60 °C for 30 s, with a melting curve of 60–95 °C. The primer sequences used in this experiment are listed in Table 1 (Sangon Biotech).Table 1

The primer sequences.

Gene	Forward [5'-3']	Reverse [5'-3']
Mouse β-Actin	GTGCTATGTTGCTCTAGACTTCG	ATGCCACAGGATTCCATACC
Mouse α-SMA	TGGCTATTCAGGCTGTGCTGTC	CAATCTCACGCTCGGCAGTAGT
Mouse collagen I	GAGCGGAGAGTACTGGATCG	GCTTCTTTTCCTTGGGGTTC
Mouse PPARɣ	AGCCCTTTACCACAGTTGATTTCTCC	GCAGGTTCTACTTTGATCGCACTTTG
Rat β-Actin	TGTCACCAACTGGGACGATA	GGGGTGTTGAAGGTCTCAAA
Rat α-SMA	GCGTGGCTATTCCTTCGTGACTAC	CATCAGGCAGTTCGTAGCTCTTCTC
Rat collagen I	TGTTGGTCCTGCTGGCAAGAATG	GTCACCTTGTTCGCCTGTCTCAC
Rat PPARɣ	CGCCAAGGTGCTCCAGAAGATG	AGGGTGAAGGCTCATATCTGTCTCC
Human β-Actin	CCTGGCACCCAGCACAAT	GGGCCGGACTCGTCATAC
Human α-SMA	TCCGGAGCGAAATACTCTG	CCCGGCTTCATCGTATTCCT
Human collagen I	CCACCAATCACCTGCGTACA	CACGTCATCGCACAACACCT
Human PPARɣ	TGAATCCAGAGTCCGCTGACCTC	ATCGCCCTCGCCTTTGCTTTG

Zeng Q., Zhou T.T., Huang W.J., Huang X.T., Huang L., Zhang X.H., Sang X.X., Luo Y.Y., Tian Y.M., Wu B., Liu L., Luo Z.Q., He B., Liu W, & Tang S.Y. (2023). Asarinin attenuates bleomycin-induced pulmonary fibrosis by activating PPARγ. Scientific Reports, 13, 14706.

+ Open protocol

+ Expand

Gene Expression Analysis by qPCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted by isolation kit (R0027, Beyotime, Beijing, China) according to the manufacturer’s instructions. cDNA was prepared with Reverse Transcription Kit (K1622, ThermoFisher Scientific). Gene expression was quantified by qPCR using SYBR Green Pro Taq HS (AG11701, Accurate Biology, Changsha, Hunan, China) in a iQ5 PCR thermal cycler (Bio-Rad). Relative gene expression was calculated by geometric averaging of multiple internal control genes, Gapdh, Cyclophilin, and Actb (Vandesompele et al. 2002 (link)). Primer sequences are available upon request.

Wei X., Tan Y., Huang J., Dong X., Feng W., Liu T., Yang Z., Yang G, & Luo X. (2024). N1-methylnicotinamide impairs gestational glucose tolerance in mice. Journal of Molecular Endocrinology, 72(2), e230126.

+ Open protocol

+ Expand

Quantification of miR-125a/b and FLT3-ITD in AML

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood samples were collected from 14 AML patients with informed consents at Queen Mary Hospital, Hong Kong. Total peripheral blood mononuclear cells were purified according to a previous protocol.²¹ The samples were confirmed to have at least 38% of leukaemia blasts. Total RNA extraction was carried out using TRIzol (ThermoFisher) based on the manufacturer's instructions. The quality and quantity of RNA samples were evaluated by NanoDrop analysis (ThermoFisher) and agarose gel electrophoresis. RNA samples were reverse transcribed into cDNAs using a reverse transcription kit (ThermoFisher) according to the manufacturer's protocol. Taqman® miRNA assays (ThermoFisher) were used to quantify the levels of miR‐125a and miR‐125b, and U6b RNA was used as the internal control. Ssofast Green qPCR kit (Bio‐Rad) was used to quantify the levels of FLT3‐ITD mRNAs, relative to the level of GAPDH. VIIA(TM) 7 System (Applied Biosystems, USA) was used to process all qPCR reactions.

Chen H., Jayasinghe M.K., Yeo E.Y., Wu Z., Pirisinu M., Usman W.M., Pham T.T., Lim K.W., Tran N.V., Leung A.Y., Du X., Zhang Q., Phan A.T, & Le M.T. (2022). CD33‐targeting extracellular vesicles deliver antisense oligonucleotides against FLT3‐ITD and miR‐125b for specific treatment of acute myeloid leukaemia. Cell Proliferation, 55(9), e13255.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from macrophages grown in the different co-culture systems using the TRIzol reagent (Invitrogen, Thermo Fisher Scientific, USA) and reverse-transcribed to single-stranded cDNA using a reverse transcription kit (Thermo Scientific) following the manufacturer’s instructions. qRT-PCR analysis was performed using a SYBR® Green PCR Master Mix (Applied Biosystems) on an ABI Prism thermal cycler (Applied Biosystems, CA, USA). The thermal cycling programme involved incubation at 50 °C for 2 min, 94 °C for 5 min, followed by 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s for 40 cycles. Melting curve analysis was performed to ensure primer specificity. All gene expression levels were normalised to the GAPDH levels. The primers used are listed in Additional file 1: Supplementary Table 1.

Su W., Yu S., Yin Y., Li B., Xue J., Wang J., Gu Y., Zhang H., Lyu Z., Mu Y, & Cheng Y. (2022). Diabetic microenvironment preconditioning of adipose tissue-derived mesenchymal stem cells enhances their anti-diabetic, anti-long-term complications, and anti-inflammatory effects in type 2 diabetic rats. Stem Cell Research & Therapy, 13, 422.

+ Open protocol

+ Expand

Metabolic Status Assessment in Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Complete RNA extraction from cell samples of all clusters was performed by using the TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and then treated with a reverse-transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was quantified by quantitative PCR, using a QuantStudio 7 Flex Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The composition of the forward and reverse primers is shown in Table 2. A set of genes for assessing the metabolic status of cells was created on the basis of large studies of key metabolic pathways in different cancer types [21 (link)]. The results were calculated by the 2-ΔΔCT method, standardized for the U6 gene.

Nikitin P.V., Musina G.R., Pekov S.I., Kuzin A.A., Popov I.A., Belyaev A.Y., Kobyakov G.L., Usachev D.Y., Nikolaev V.N, & Mikhailov V.P. (2022). Cell-Population Dynamics in Diffuse Gliomas during Gliomagenesis and Its Impact on Patient Survival. Cancers, 15(1), 145.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RNA from cells was extracted using TRIzol^® (cat. no. R0016; Beyotime Institute of Biotechnology). RNA purity (OD260 nm/OD280 nm=1.8-2.2) was evaluated using NanoDrop 2000 (Thermo Fisher Scientific, Inc.) and reversely transcribed to cDNA with a reverse transcription kit (cat. no. 11139ES10; Yeasen Biotechnology Co., Ltd.) according to the manufacturer's instructions. qPCR was performed using SYBR Green Master Mix (cat. no. 11203ES03; Yeasen Biotechnology Co., Ltd.) in a fluorescence quantitative PCR instrument (CFX; Bio-Rad Laboratories, Inc.). The thermal cycling program was as follows: pre-denaturation for 30 sec at 95°C, denaturation for 15 sec at 95°C, and annealing and extension for 30 sec at 60°C, with repetition for 40 cycles. The primer sequences were as follows: GBP2 forward, 5′-CAGTTGGAAGCAAGGCGAGAT-3′ and reverse, 5′-GCACCTCTTTGGCCTGTATCC-3′; PD-L1 forward, 5′-GCCGAAGTCATCTGGACAAGC-3′ and reverse, 5′-GTGTTGATTCTCAGTGTGCTGGTCA-3′; and β-actin forward, 5′-CACCCAGCACAATGAAGATCAAGAT-3′ and reverse, 5′-CCAGTTTTTAAATCCTGAGTCAAGC-3′. Relative expressions levels were normalized to those of human β-actin. 2^−ΔΔCq method was used to analyze the data (35 (link)).

Ye S., Li S., Qin L., Zheng W., Liu B., Li X., Ren Z., Zhao H., Hu X., Ye N, & Li G. (2023). GBP2 promotes clear cell renal cell carcinoma progression through immune infiltration and regulation of PD‑L1 expression via STAT1 signaling. Oncology Reports, 49(3), 49.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with the InviTrap Spin Universal RNA Mini Kit (Stratec Molecular, Berlin, Germany). The A₂₆₀/A₂₈₀ ratio of the optical density of the RNA samples (measured with NanoDrop1000; peQLab, Erlangen, Germany) was between 1.95 and 2.05, indicating adequate RNA quality. The RNA samples were treated with DNase I, and cDNA was synthesized from 0.5 µg RNA with a reverse transcription kit (ThermoFisher Scientific).

Messerschmidt L., Fischer S., Wiedemann P., Bringmann A, & Hollborn M. (2019). Osmotic induction of cyclooxygenase-2 in RPE cells: Stimulation of inflammasome activation. Molecular Vision, 25, 329-344.

+ Open protocol

+ Expand

Real-Time qPCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

To examine messenger (m)RNA expression, total RNA was extracted
followed manufacturer’s instructions of the RNeasy Mini Kit (Qiagen). One
microgram of total RNA was reverse-transcribed with a reverse transcription kit
(Thermo-Fisher Scientific, Waltham, MA, USA) into complementary (c)DNA, and used
as the template for real-time PCR reactions and analyses. The real-time PCRs
were performed using SYBR Green reagent (Bio-Rad, Hercules, CA, USA) on
CFX-Real-Time qPCR (Bio-Rad). The cDNA amount was analyzed by a qPCR with SYBR
Green reagent (Bio-Rad) according to manufacturer’s instructions and used ΔΔCt
to evaluate the relative multiples of change between the target gene and
internal control, GAPDH. Primers used for the qPCR are indicated as follow:Nrf2 (sense) 5′-CGCTTGGAGGCTCATCTCACA,Nrf2 (antisense)
5′-CATTGAACTGCTCTTTGGACATCA; and GAPDH(sense) 5′-CGA CAG TCA GCC GCA TCT TCT TT -3′ and GAPDH (antisense) 5′-GGC AAC AAT ATC CAC TTT ACC AGA G -3′. This
involved an initial denaturation at 95 °C for 5 min, followed by 40 cycles of
denaturing at 95 °C for 5 s and combined annealing/extension at 60 °C for 10 s,
as described in the manufacturer’s instructions.

Wang C.K., Chen H.C., Fang S.U., Ho C.W., Tai C.J., Yang C.P, & Liu Y.C. (2018). Innovatively Therapeutic Strategy on Lung Cancer by Daily Drinking Antioxidative Plasmon-Induced Activated Water. Scientific Reports, 8, 6316.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!