Rnapure plant kit dnase 1

Total RNA was extracted from two sweetpotato lines SR at 60, 90, 120, and 150 DAP using the RNApure Plant Kit (DNase I) (CWBIO, Beijing, China). cDNA was reverse-transcribed using the SuperScript II Kit (TaKaRa, Beijing, China) according to the manufacturer’s instructions. Four selected DEGs from the RNA-Seq were validated using quantitative real-time PCR (qRT-PCR) with the one-step real-time PCR System (Applied Biosystems, Foster, USA). The qRT-PCR of each reaction (total volume 20 μL) contained 10 μL of SYBR Master Mix (2×, (TaKaRa, Dalian, China), 1.0 μL of primers, 1.0 μL of the cDNA template, and 7 μL of RNase-free water. The 2^−ΔΔCT method was used to calculate the relative expression levels of genes [24 (link)]. The sweetpotato tublin gene was used as a reference. The PCR procedure was: 95 °C for 60 s, 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s, and elongation at 72 °C for 20 s, then a melting curve was generated and analyzed. All the primers used for the qRT-PCR validation are listed in Table S3. Three biological replicates were used in statistical analysis and the values in figures were means ± SD (standard deviation). Statistically significant differences at p < 0.05 and p < 0.01 were indicated by asterisks * and **, respectively.

The transcript abundance of several GmLEA genes was investigated using qRT-PCR. Total RNA was extracted from the roots and leaves of the G. max seedling under the stress treatment and the unstressed control using an RNApure Plant Kit (DNase I) (CWBIO, Cat: # CW0559, Taizhou, China) according to the manufacturer’s instructions. Approximately 2 μg of total RNA was reverse transcribed into cDNA in a 20 μL reaction volume using the HiScript 1st Strand cDNA Synthesis Kit (Vazyme, Cat: # R111-01, Nanjing, China) following the supplier’s instructions. Quantitative RT-PCR was performed using the Bio-Rad CFX ConnectTM Optics Module Real-Time PCR System (Bio-Rad, Ontario, CA, USA) and iTaq Universal SYBR Green Supermix (Bio-Rad, Cat: #1725122, Ontario, CA, USA). The constitutive Gmactin11 gene, with forward “ATCTTGACTGAGCGTGGTTATTCC” and reverse sequence “GCTGGTCCTGGCTGTCTCC” was used as a reference gene and specific LEA genes primers were used for qRT-PCR validation. The relative gene expression data obtained via qRT-PCR were normalized to the expression of the GmActin gene. The 2^-ΔΔCt method was used to calculate the relative expression of GmLEA genes. Each sample has three replicates, and three biological experiments were performed. The primers used for qRT-PCR are listed in Table S7.

To validate their expression in the root, stem, leaf, flower, and bud of JLCMS5A and JLR2, the candidate genes were analyzed by real-time quantitative PCR (qRT-PCR). Total RNA was extracted using the RNApure Plant Kit (DNase I) (CWBIO, Jiangsu, China), and first-strand cDNA was synthesized using the SuperRT cDNA Synthesis Kit (CWBIO, Jiangsu, China) according to the manufacturer’s protocol. The housekeeping gene Cons4 (GenBank accession number: BU578186) was used as the reference gene. All primer sequences used in the present study are listed in Table S3. qRT-PCR was performed in triplicate using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on the StepOnePlus Real-Time PCR System (Thermo Fisher, Waltham, MA, USA). Statistical analysis was performed using the well-known 2^−ΔΔCT method [41 (link)]. All data are expressed as mean ± standard deviation.