T7 high yield rna transcription kit

The RNA pull-down assay was performed using the Pierce™ magnetic RNA-protein pull-down kit (Thermo Scientific). Full-length LINC00958 was obtained using in vitro transcription with the T7 high yield RNA transcription kit (TR101; Vazyme). Next, the RNA was biotinylated using the Pierce™ RNA 3′ end desthiobiotinylation kit (Thermo Scientific). Cell extracts were incubated with RNAs for 20 min, followed by incubation with nucleic acid-compatible streptavidin magnetic beads (Thermo Scientific). The samples were washed five times and the LINC00958-associated proteins retrieved from the beads were subjected to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and silver staining. The proteins collected from the RNA pull-down were quantified using liquid chromatography-tandem mass spectrometry (LC-MS/MS).

DNA templates for dsRNA synthesis were amplified by PCR using primers with the T7 promoter at both ends, namely Vta1 (Asia II 1)-T7-F, Vta1 (Asia II 1)-T7-R, Vta1 (MEAM1)-T7-F, and Vta1 (MEAM1)-T7-R (Table S1). DsRNA synthesis was conducted with a T7 high-yield RNA transcription kit (Vazyme, Nanjing, China). Next, dsRNA was purified, and the quality and concentration were determined using agarose gel electrophoresis and Nanodrop (Thermo Fisher, Waltham, MA, USA). For membrane feeding, dsRNA-targeting Vta1 or GFP (control) was added to 15% sucrose solution to make the final concentration 200 ng/μL. Whiteflies were collected and released into artificial diet feeding chambers, as described before [8 (link)]. The duration of membrane feeding was 48 h.

RNA pull‐down experiments were performed using the Pierce™ Magnetic RNA‐Protein Pull‐Down Kit (#20164, Thermo Fisher) according to the manufacturer's instructions. The full‐length AFDN‐DT RNA was obtained using in vitro transcription with the T7 High Yield RNA Transcription kit (TR101, Vazyme), following which the RNA was biotinylated using the Pierce™ RNA 3´ Desthiobiotinylation Kit (# 20163, Thermo Fisher). LC‐MS/MS was performed at Shanghai Cutseq Bio‐medical Technology Co. Ltd.

In brief, a target site (GGTCTACTGTCGCCCACAGCTGG) in exon 1 of the nlrc3 gene was chosen, and the guide RNA (gRNA) template was amplified from the pMD-gata5-gRNA scaffold vector. In vitro transcription was performed using 1 μg of template DNA and T7 RNA polymerase. Zebrafish codon-optimized Cas9 plasmid was linearized with XbaI, and Cas9-capped mRNA was transcribed using the T7 High Yield RNA Transcription Kit (Vazyme; TR101-01). The size and quality of the capped mRNA and gRNA were confirmed by electrophoresis through a 2% (w/v) agarose gel. Subsequently, 100 pg of gRNA and 400 pg of Cas9 mRNA (New England Biolabs; M0646T) for microinjection into one-cell stage embryos. The following primer pairs and the restriction enzyme BstXI were used to assess the efficiency of genetic disruption: forward5’-ACTTTGGGTCGTCTTGCTTTTTA-3’, reverse5’-AACAAATAGGCGAGAACAGCACA-3’. F0 embryos with the highest editing efficiency were raised. Heterozygous F1 fish were identified using DNA sequencing of the offspring of F0 fish outcrosses. The mutant and wild-type animals were obtained from heterozygous crosses.