Duffy genotypes were determined for all blood samples by allele-specific PCR using the protocol described by Olsson et al. [34 (link)], with some modifications. Four PCRs were performed on each sample to genotype FY*A, FY*B, FY*AES and FY*BES alleles. The combination of GATAFY2 and FYAREV identified the FY*AES allele, GATAFY2 and FYBREV identified the FY*BES allele, FYAB2 and FYAREV primers the FY*A allele, and FYAB2 and FYBREV primers the FY*B allele. PCR was performed using OneTaq® Quick-Load® 2× Master Mix with standard buffer (NEB) and 0.4 µM of each primer. In addition, co-amplification of the human growth hormone gene (HGH) using 0.04 µM each of the HGH-F and HGH-R primers was run as an amplification control [35 (link)]. PCR reactions were carried out in a SEEAMP™ SCE1000 thermal cycler (Seegene Inc., Seoul, Korea). Primers and PCR conditions are shown in Table 1 .
Onetaq quick load 2 master mix
Manufactured by New England Biolabs
Sourced in United States
OneTaq Quick-Load 2 Master Mix is a ready-to-use solution for PCR amplification. It contains Taq DNA polymerase, dNTPs, and buffer components necessary for PCR.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Gene reagent pack, by Qiagen (2 mentions)
Science x tractor platform, by Qiagen (2 mentions)
Biodoc it imaging system, by Analytik Jena (2 mentions)
Biometra trio thermal cycler, by Analytik Jena (2 mentions)
Easy dna gdna purification kit, by Thermo Fisher Scientific (2 mentions)
Seeamp sce1000 thermal cycler, by Seegene (1 mentions)
50 bp dna ladder, by New England Biolabs (1 mentions)
Nuclease free water, by BioConcept (1 mentions)
Quick dna fungal bacterial miniprep kit, by Zymo Research (1 mentions)
Megascript t7 transcription kit, by Thermo Fisher Scientific (1 mentions)
8 protocols using onetaq quick load 2 master mix
1
Allele-Specific PCR for Duffy Genotyping
2
Candida Species Identification from Vaginal Swabs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Deoxyribonucleic acid (DNA) extraction and purification from vaginal swabs were performed using the Quick-DNA™ Fungal/ Bacterial Miniprep Kit (Zymo Research, USA) according to the manufacturer’s guidelines. Multiplex PCR was performed using the One Taq® Quick-Load 2 × Master Mix (New England BioLabs, USA), a universal Candida primer pair targeting ITS1 and ITS2 and C. albicans specific primers according to Rad et al. [19 (link)]. The PCR products were then analysed with the 50 bp DNA ladder (New England BioLabs, USA) by gel electrophoresis through a 2% agarose gel and ultraviolet visualisation [19 (link)]. Candida albicans ATCC 14053, C. glabrata CBS2175, C. parapsilosis CBS2195, C. tropicalis CBS94, and C. krusei CBS473 were included in each PCR reaction as positive controls; nuclease-free water (BioConcept, Switzerland) was used as negative control.
3
ERIC-PCR Profiling of Lm Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The molecular diversity of the previously identified Lm isolates was determined by ERIC-PCR using the primer sets ERIC-1 5′-ATGTAAGCTCCTGGGGATTCAC-3′ and ERIC-2 5′-AAGTAAGTGACTGGGGTGAGCG-3′31 (link). The PCR reaction was prepared in a final volume (25 µL) containing 1 µl of ERIC primers, 12.5 µl master mix (One taq Quick Load 2 × Master mix, New England BioLabs Inc.), 3 µl aliquots of DNA, 0.5 µl of MgCl2, buffer, and 6.5 µl of sterile nuclease-free water. The thermal cycling program for the ERIC-PCR was 95 °C—5 min, 35 cycles (94 °C—1 min, annealing 35 °C—1 min, 72 °C—2 min), a final step of 72 °C—10 min and held refrigerated at 4 °C. The reaction products (5–10 µl) were separated in a 1.5% agarose gel stained with ethidium bromide (3 µl) and suspended in a 5 × TBE buffer subjected to 90 V for 240 min using a Bio-Rad electrophoresis machine (Bio-Rad® PowerPac™ Basic Power Supply, Singapore). An appropriate volume of DNA ladder ranging from 100 bp and 10 kb was put in the gel. The gel image was captured and recorded using Alliance 4.7 UV trans-illuminator (Alliance XD-79.WL/26MX, France).
4
dsRNA Synthesis for Aedes Gene Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For dsRNA synthesis, a T7 promoter sequence, TAATACGACTCACTATAGGGAGA, was added to the 5′ end of each primer as listed in SI Appendix, Table S5 . PCR was performed using the OneTaq-Quick-Load 2× Master Mix (New England BioLabs) with Aedes whole-body cDNA as a template, and the amplified PCR products were cleaned using the Gel DNA Recovery Kit (Zymoclean). dsRNA was synthesized using the MEGAscript T7 Transcription Kit (Ambion).
5
PCR Detection of Clostridium difficile Toxin Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For PCR analysis, DNA was isolated from each of the bacterial pellets using the Gene Reagent Pack on the Corbett Life Science X-tractor platform (Qiagen, Valencia, CA, USA). The concentration of the extracted DNA was determined using NanoDrop (ThermoScientific, Wilmington, DE, USA). PCR was performed using primers specific for toxins A and B (TcdA2), TcdC (TNC), and the 16S ribosomal RNA gene (16S rRNA) as control (Fiedoruk et al., 2015 (link); Fry et al., 2012 (link); Griffiths et al., 2010 (link); Lemee et al., 2004 (link); Li et al., 2017 (link); Liu et al., 2018 (link); Murray et al., 2009 (link)). The sequences of the primers used are: TcdA2 F-50AGATTCCTATATTTACATGACAATAT30, R- 5´GTATCAGGCATAAAGT AATATACTTT3´; TNC F- 5´GAGCACAAAGGGTATTGCTCTACTGGC3´, R- 5´CCAGACACAGCTAATCTTATTTGCACCT3´; 16S rRNA F- 5´ACACG GTCCAAACTCCTACG3´, R-5´AGGCGAGTTTCAGCCTACAA3´. The PCR amplification was done using OneTaq Quick-Load 2 Master Mix (New England Biolabs, Ipswich, MA, USA) with an initial denaturationtemperatureof94 Cfor 30 sand 36cyclesof94 Cfor30 s,55 C for 30 s, and 68 C for 30 s, with a final extension of 68 C for 5 min. The PCR products were analyzed using 1% agarose gel electrophoresis, stained with ethidium bromide, and imaged using BioDoc-It Imaging System (UVP, Upland, CA, USA).
6
Genomic DNA Isolation and PCR Amplification
7
Genomic DNA Isolation and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated by Easy-DNA gDNA purification kit (Invitrogen) according to manufacturer’s instructions. OneTaq Quick-Load 2× Master Mix (New England Biolabs) was used for standard PCR according to manufacturer’s instructions. Reaction was performed as following protocol: 94 °C for 1 min; 35 cycles of reaction: 94 °C for 30 s, 56 °C for 45 s and 68 °C for 1 min; and 68 °C for 5 min on a Biometra TRIO Thermal Cyclers (Analytik Jena). The product sizes of PCR are 1370 bp using p53_5FM13 and 3FNF-N1 primers, 368 bp and 432 bp (with Frt footprint) using p53_7FM13 and p53_7RM13 primers, and 1606 bp using 3p53_16821 and 5FNF-C1 primers.
8
PCR Detection of Clostridium difficile Toxin Genes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!