Six normal liver tissues and six fatty liver tissues from liver donors were enrolled in our study to validate the expression levels of related genes. All tissues were histologically diagnosed. Prior patient consent and ethical approval from the ethics committee of the First Affiliated Hospital, Sun Yat-sen were obtained. All methods were performed in accordance with the ethics guidelines and regulations. Total RNA from tissues was isolated with TRIzol reagent (Invitrogen) in accordance with the manufacturer’s protocol. cDNA synthesis was performed according to standard procedures using primeScript RT Master kit (Takara Bio Inc.). Quantitative RT-PCR was performed by SYBR Green quantitative PCR kit (Takara Bio Inc.) using the LC480 Real-Time PCR System (Roche). The primer sequences are provided in Table S1 . β-tubulin was used as a reference gene. Every test was repeated by three replicates. Data was presented as mean ± SEM and Student’s t-test was used to evaluate statistical difference.
Primescript rt master kit
Manufactured by Takara Bio
Sourced in Japan, China
The PrimeScript RT Master Kit is a laboratory equipment product designed for reverse transcription (RT) reactions. It is a complete kit that includes all the necessary components for the synthesis of first-strand complementary DNA (cDNA) from RNA templates.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (25 mentions)
Trizol, by Thermo Fisher Scientific (12 mentions)
Viia 7 system, by Thermo Fisher Scientific (7 mentions)
Rnaiso plus kit, by Takara Bio (6 mentions)
Trizol reagent, by Takara Bio (5 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (5 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (5 mentions)
Sepasol reagent, by Nacalai Tesque (4 mentions)
Thermal cycler dice real time system single, by Takara Bio (4 mentions)
Trizol, by Merck Group (4 mentions)
Aceq qpcr sybr green master mix, by Vazyme (4 mentions)
Sybr green pcr master mix, by Takara Bio (4 mentions)
Trizol reagent, by Merck Group (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Sybr premix ex taq, by Takara Bio (3 mentions)
Sybr premix ex taq kit, by Takara Bio (3 mentions)
Lightcycler 480 real time pcr system, by Roche (3 mentions)
Sybr green quantitative pcr kit, by Takara Bio (2 mentions)
Lc480 real time pcr system, by Roche (2 mentions)
80 protocols using primescript rt master kit
1
Validating Gene Expression in Fatty Liver
2
Real-Time RT-qPCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using the RNAiso Plus kit (Takara Bio Inc.) and cDNA preparation was performed in accordance with manufacturer’s instructions using primeScript RT Master kit (Takara Bio Inc.). Real-time RT–qPCR was performed with SYBR qPCR SuperMix Plus (Annoronbio, China) using the 7300 Real-Time PCR System or ViiA7 System (AB Applied Biosystems). GAPDH was used as control. The primers used were as follows:
| | Forward (5′-3′) | Reverse (5′-3′) |
| GAPDH | AGAAGGCTGGGGCTCATTTG | AGGGGCCATCCACAGTCTTC |
| SNF5 | GACGACGGCGAGTTCTAC | TCCTCTTGGCCTTCTGTT |
| PD-L2 | ACCCTGGAATGCAACTTTGAC | AAGTGGCTCTTTCACGGTGTG |
| IDO1 | TCTCATTTCGTGATGGAGACTGC | GTGTCCCGTTCTTGCATTTGC |
| PD-L1 | TGGCATTTGCTGAACGCATTT | TGCAGCCAGGTCTAATTGTTTT |
| p21 | CGATGGAACTTCGACTTTGTCA | GCACAAGGGTACAAGACAGTG |
| Cyclin D1 | TGGAGCCCGTGAAAAAGAGC | TCTCCTTCATCTTAGAGGCCAC |
| TGF-β1 | ATGGTGGAAACCCACAACGA | GCTGAGGTATCGCCAGGAAT |
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA including miRNA was isolated using TRIzol reagent (Invitrogen, USA) according to the manufacturer's protocol. The RNA concentration and quality were determined by spectrophotometry using NanoDrop™ 2000 (Thermo Scientific, USA). For mRNA detection, 1 μg of total RNA was reversely transcribed by primeScript RT Master kit (Takara Bio Inc., Japan). Quantitative real-time PCR reaction was performed with SYBR Green using the ViiA7 System (AB Applied Biosystems, USA). The primers used in this study were shown as follows: Il1b forward, 5′-GCAACTGTTCCTGAACTCAACT-3′; Il1b reverse, 5′-ATCTTTTGGGGTCCGTCAACT-3′; Il6 forward, 5′-TAGTCCTTCCTACCCCAATTTCC-3′; Il6 reverse, 5′-TTGGTCCTTAGCCACTCCTTC-3′; Tnf forward, 5′-CCCTCACACTCAGATCATCTTCT-3′; Tnf reverse, 5′-GCTACGACGTGGGCTACAG-3′; Nos2 forward, 5′-GTTCTCAGCCCAACAATACAAGA-3′; Nos2 reverse, 5′-GTGGACGGGTCGATGTCAC-3′; Ptgs2 forward, 5′-TTCAACACACTCTATCACTGGC-3′; Ptgs2 reverse, 5′-AGAAGCGTTTGCGGTACTCAT-3′; and Actb forward, 5′-GGCTGTATTCCCCTCCATCG-3′; Actb reverse, 5′-CCAGTTGGTAACAATGCCATGT-3′. MicroRNA real-time transcription-PCR quantification of miRNA expression was carried out using a Hairpin-it miRNA RT-PCR Quantitation Kit and TaqMan-microRNA assay kit (GenePharma, Suzhou, China) according to the manufacturer's protocol. U6 RNA was set as an internal control.
4
Quantitative Real-Time PCR of Liver mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from livers using Sepasol reagent (Nacalai Tesque, Kyoto, Japan) and reverse-transcribed using the PrimeScript RT Master kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s protocols. Quantitative real-time PCR (qPCR) was performed using SYBR Premix Ex Taq (Takara Bio Inc. Shiga, Japan) and specific primer sets with the Thermal Cycler Dice Real Time System Single (Takara Bio Inc. Shiga, Japan). Primer sequences for qPCR in this study have been described previously [18 (link),19 (link),34 (link),36 (link)]. The expression levels of mRNA were normalized to those of cyclophilin mRNA.
5
RNA extraction and RT-qPCR analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was obtained from osteoblasts using TRIzol (Sigma, T9424) and was reverse-transcribed into cDNA using the PrimeScript RT master kit (TakaRa Bio Inc., RR036A). Real-time reverse transcription PCR was performed using the Bio-Rad CFX96 system. The primer sets used were as follows:
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from longissimus dorsi muscle, other tissues (liver, spleen, kidney, heart, and adipose), and cells were extracted using TRIzol (Invitrogen, Carlsbad, CA, USA), and then reverse transcribed into complementary DNA (cDNA) using Primescript RT Master Kit (Takara, Dalian, China) according to the manufacturer’s instructions. Primers of DEGs were designed by Primer 3 (http://bioinfo.ut.ee/primer3/ ) [31 (link),32 (link)] and are listed in Table S1 . Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed with AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) in a reaction volume of 20 μL. The cycling parameters were as follows: 95 °C for 5 min, followed by 40 amplification cycles, each at 95 °C for 10 s, then 60 °C for 30 s. All reactions were performed in triplicate for each sample. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as internal control to normalize the relative expression of genes. The gene expression levels were calculated by the ΔΔCt value method [33 (link)].
7
Quantitative Real-time RT-PCR Assay for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To perform quantitative real-time RT-PCR, total RNA from cells were extracted through RNAiso Plus kit (Takara Bio Inc.). The cDNA preparation was achieved based on standard procedures using primeScript RT Master kit (Takara Bio Inc.). Real-time PCR was performed by SYBR gGreen quantitative PCR kit (Life Technology) using the 7500 Real Time PCR System or ViiA7 System (AB Applied Biosystems). The primers used in the mRNA levels detection were as follows: human GAPDH-F: CATGAGAAGTATGACAACAGCCT, human GAPDH-R: AGTCCTTCCACGATACCAAAGT; TGFBR1-F: AAGAACGTTCGTGGTTCCGT, TGFBR1-R: CACCAACCAGAGCTGAGTCC; TGFBR2-F: GCACGTTCAGAAGTCGGATG; TGFBR2-R: CTGCACCGTTGTTGTCAGTG, human CAV1-F: CGCGACCCTAAACACCTCAA; human CAV1-R: TCGTCACAGTGAAGGTGGTG.
8
Total RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a Cell Total RNA Isolation Kit (Forgene, RE-03113) according to the manufacturers’ protocol. Briefly, after washing once with PBS buffer, cells were lysed by Buffer cRL1 (<106 cells add 250 μl). Cell lysate was transferred to a DNA-Cleaning Column for centrifugation, and Buffer cRL2 was added to the resulting supernatant (Volume of supernatant: Buffer cRL2 = 1:1.6). The mixture solution was transferred to an RNA-Only Column for centrifugation. After washing the column once with buffer RW1 and twice with RW2, total RNA was eluted with RNase-Free ddH2O. Reverse transcription was carried out using the PrimeScript RT Master Kit (Takara, RR036A) according to the manufacturer’s protocol. Quantitative PCR using novo Start SYBR qPCR SuperMix Plus (Novoprotein, E096-01B) was performed using a CFX96 Real Time PCR System (Bio-Rad). ACTB was used as an internal control to normalize target genes. Primers used in this study are listed in Table S7 .
9
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Trizol reagent (Invitrogen) according to the manufacturer’s recommendation. Two hundred nanograms of mRNA were used, and cDNA was synthesized using PrimeScript RT Master Kit (Takara, Dalian, China). The qRT-PCR was performed on 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR Green methods as described previously.17 (link) The primers used are shown in Table S1 . GAPDH was used as internal control.
10
Liver Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from livers using Sepasol reagent (Nacalai Tesque, Kyoto, Japan) and was reverse-transcribed using the PrimeScript RT Master kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s protocols. qPCR was performed using SYBR Premix Ex Taq (Takara Bio Inc.) and specific primer sets with the Thermal Cycler Dice Real Time System Single (Takara Bio Inc.). Primer sequences for Acat2, Nr1h3, Ces3a, Ces3b, Nr1h4, Nr5a2, Nr0b2, Cyp7a1, Cyp8b1, Cyp27a1, Cyp7b1, Slc10a1, Slco1a1, Abcb11, Abcc2, Abcc1, Abcc3, Abcc4, Slc51b, Cd14 and Cybb are summarized in Supplementary Table S2 online. Other qPCR primers used have been described previously16 (link)23 (link)49 (link). The expression levels of mRNA were normalized to those of peptidylprolyl isomerase A (Ppia) mRNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!