Dna engine peltier thermal cycler
The DNA Engine Peltier Thermal Cycler is a laboratory instrument used for the amplification of DNA samples. It precisely controls the temperature and timing of the thermal cycling process, which is a fundamental technique in molecular biology and genetics.
Lab products found in correlation
48 protocols using dna engine peltier thermal cycler
Cloning and Sequencing of Differentially Expressed Genes
Tick Identification and Pathogen Screening
Molecular assays were used to screen for infections with Babesia spp., E. canis, Hepatozoon spp., A. platys, and A. phagocytophilum. DNA was extracted from 100 microliters of whole blood using the DNAeasy Blood and Tissue kit, (Qiagen, Hilden, Germany). PCR was conducted using a BioRad DNA Engine Peltier Thermal Cycler (Bio-Rad Laboratories Incorporated, Foster City, CA) and published protocols (
Genomic DNA Extraction and Polymorphism Analysis
Enterococcal Virulence Factors Screening
RNA Extraction and qRT-PCR Analysis
Northern analysis were carried out as previously described [
Genotyping of ANK3 and CACNA1C SNPs
Quantitative HIV-1 DNA Integration Analysis
BDNF Expression Analysis by qPCR
TCGTTCCTTTCGAGTTAGCC (mBDNFexS)
TTGGTAAACGGCACAAAAC (mBDNFexAS)
AGGTATCCTGACCCTGAAG (mActinS)
GCTCATTGTAGAAGGTGTGG (mActinAS).
The resulting data was analyzed using MJ Opticon Monitor (BioRad) and mRNA expression was measured with satisfactory reproducibility between triplicates and fold change relative to average ΔCt was calculated as 2−ΔΔCt and normalized to actin.
Gene Expression Analysis by qPCR
Cloning and Sequencing of Mite Genes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!