Based on the specification offered by the supplier, the EZ‐Magna RIP kit (Millipore, Billerica, MA, USA) was employed to conduct RIP assay. A549 or SPC‐A1 cells were collected via centrifugation and subsequently lysed in RIP lysis buffer (Thermo Fisher Scientific). Cell lysates were subjected to immunoprecipitation with antibody against Ago2 (Millipore) or IgG (Millipore). The immunoprecipitated RNA was harvested and then augmented with qRT‐PCR using the Primer Script RT Master Mix kit (TaKaRa).
Primerscript rt master mix kit
Manufactured by Takara Bio
Sourced in China, Japan
The PrimerScript RT Master Mix kit is a reagent used for reverse transcription of RNA to cDNA. It contains all the necessary components required for the reverse transcription reaction, including a reverse transcriptase enzyme and a ribonuclease inhibitor.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Tb green premix ex taq kit, by Takara Bio (3 mentions)
Recombinant dnase 1, by Takara Bio (2 mentions)
Sybr green master mix kit, by Thermo Fisher Scientific (2 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taq 2 kit, by Takara Bio (2 mentions)
Ez magna rip kit, by Merck Group (1 mentions)
Rip lysis buffer, by Thermo Fisher Scientific (1 mentions)
Reverse transcription system, by Promega (1 mentions)
Abi 7900 system, by Thermo Fisher Scientific (1 mentions)
Subcellular fractionation kit for cultured cell, by Thermo Fisher Scientific (1 mentions)
Sybr select master mix, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Takara Bio (1 mentions)
7900 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Powerup sybr green master mix reagent, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (1 mentions)
Cfx96 touch system, by Bio-Rad (1 mentions)
Minibest universal rna extraction kit, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Universal sybr green master mix, by Roche (1 mentions)
15 protocols using primerscript rt master mix kit
1
Ago2-RIP Assay for RNA Interactome
2
Quantifying Gene Expression in Cetuximab-Treated Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA of cell lines treated with cetuximab was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) under the manufacturer’s instructions. Recombinant DNase I (Takara Bio, Beijing, China) was used to remove potential genomic DNA contamination. cDNA was generated with the PrimerScript™ RT master mix kit (Takara Bio, Dalian China). Real-time quantitative PCR analysis of the identified DEGs was performed using the TB Green Premix Ex Taq™ kit (Takara Bio, Dalian China). All results were normalized to human GAPDH mRNA expression. The primers were listed in Additional file 1 : Table S1. The relative threshold cycle (Ct) method was used to display the results.
3
MCF-7 RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from MCF-7 cells using TRIzol reagent (Thermo Fisher Scientific) following the manufacturer's instructions. Then, reverse transcription of total RNA into cDNA was performed using the Reverse Transcription System (A3500; Promega Corp., Madison, WI, USA) and PrimerScript RT Master Mix kit (Takara Bio, Dalian, China). Briefly, a total 20 µl of reverse-transcription reaction solution was prepared containing 4 µl of 5X RT Master Mix and 800 ng RNA and the mixture was reacted at 85°C for 2 min and 37°C for 30 min. PCR was performed using 7500 Realtime PCR System (Applied Biosystems Life Technologies, Foster City, CA, USA) and SYBR-Green master mix kit (Applied Biosystems Life Technologies). The relative expression of target genes were calculated as ΔCq=Cq gene-Cq reference, and the fold change of target gene expression was calculated by the 2−ΔΔCq method. GAPDH was used as the reference gene. Experiments were repeated in triplicate. Primer sequences were listed as follows: Cyclin D1 forward TGGAGGTCTGCGAGGAACA, cyclin D1 reverse TTCATCTTAGAGGCCACGAACAT; cyclin E forward AGCCAGCCTTGGGACAATAAT, cyclin E reverse GAGCCTCTGGATGGTGCAAT; p27 forward CTGCAACCGACGATTCTTCTACT, p27 reverse CTTCTGAGGCCAGGCTTCTT; GAP DH forward AAGATCATCAGCAATGCCTCCT, GAP DH reverse TGGTCATGAGTCCTTCCACGAT.
4
Comprehensive RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to isolate total RNA according to the manufacturer's instructions. For cellular fractionation, Subcellular Fractionation Kit for Cultured Cells (Thermo Fisher Scientific, Inc.; cat. no. 78840) was used according to the manufacturer's instructions. Total RNA (1 µg) was used to perform reverse transcription using Primer Script RT Master Mix kit (Takara Bio, Inc.; cat. no. RR036A) under following conditions: 30 min at 37°C, 5 min at 85°C and holding at 4°C. qPCR analysis was performed using SYBR Select Master Mix (Applied Biosystems, Inc.; cat. no. 4472908) on the ABI 7900 system (Applied Biosystems, Inc.). The thermocycling conditions for the qPCR consisted of 30 sec at 95°C, followed by 40 cycles of 5 sec at 95°C and 60 sec at 60°C. The relative gene expression levels were normalized against GAPDH gene using the 2−ΔΔCq method (30 (link)). The following PCR primers were used in the study: i) GAPDH forward, 5′-CCACATCGCTCAGACACCAT-3′ and reverse, 5′-ACCAGGCGCCCAATACG-3′; ii) LINC01207 forward, 5′-CAGACACAGGCCATTCAGTC-3′ and reverse, 5′-CTTCTTCACCAGAAGCATTCC-3′; iii) miR-1182 forward, 5′-GGGGAGGGTCTTGGGAGGGA-3′ and reverse, 5′-GTGCAGGGTCCGAGGT-3′; iv) AKT3 forward, 5′-AATGGACAGAAGCTATCCAGGC-3′ and reverse, 5′-TGATGGGTTGTAGAGGCATCC-3′; U6 forward, 5′-CTCGCTTCGGGCAGCACA-3′ and reverse, 5′-AACGCCTTCCACGAATTTGCGT-3′.
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from the cells and tissues using TRIzol reagent (Life Technology, St. Louis, MO, USA) according to the manufacturer's instructions. cDNA was obtained using the PrimerScript RT Master Mix kit (Takara, Dalian, China). 20 µl of reverse-transcription reaction solution consisted of 4 µl 5X RT Master Mix and 800 ng RNA. The reaction procedure was 85°C, 2 min and 37°C, 30 min. Quantitative PCR was performed using SYBR-Green PCR Master mix (Takara Bio, Inc., Shiga, Japan) in a total volume of 20 µl on 7900 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) as follows: 95°C for 30 sec, 40 cycles of 95°C for 5 sec, 60°C for 30 sec. β-actin was used as the reference gene. The relative levels of gene expression were calculated using the 2−ΔΔCq method. The sequences of the primers are listed as follows: Eya2 forward, 5′-CACTCCCTGAAGGCACTAAACCTCATC-3′ and reverse, 5′-CTGCATTATCCTCTCGAAGCAGCTCTC-3′; cyclin D1 forward, 5′-TGGAGGTCTGCGAGGAACA-3′ and reverse, 5′-TTCATCTTAGAGGCCACGAACAT-3′; cyclin E forward, 5′-AGCCAGCCTTGGGACAATAAT-3′ and reverse, 5′-GAGCCTCTGGATGGTGCAAT-3′; MMP9 forward, 5′-CCTCTGGAGGTTCGACGTGA-3′ and reverse, 5′-TAGGCTTTCTCTCGGTACTGGAA-3′; actin forward, 5′-ATAGCACAGCCTGGATAGCAACGTAC-3′ and reverse, 5′-CACCTTCTACAATGAGCTGCGTGTG-3′.
6
Validation of RNA-Seq Differential Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight putative genes (Unigene0104732, Unigene0028215, Unigene0083695, Unigene0069097, Unigene0090596, Unigene0024962, Unigene0007135 and Unigene0088781) were randomly selected to verify the accuracy of the RNA-Seq results by the qRT-PCR technique. The total RNA was extracted with Omega RNA Extraction Kit (Shanghai, China), and then reverse-transcribed the 1-strand cDNA by using the PrimerScript™ RT Master Mix Kit (TaKaRa, Dalian, China). Specific primers of DEGs are designed via the Primer-BLAST server (S1 Table ). qRT-PCR samples were labelled with PowerUp™ SYBR Green Master mix reagent (Thermo Fisher, China) and then performed on ABI ViiA™ 7 Real-time PCR system (ABI, USA). A total of 3 biological repeats were performed, each with 4 technical repetitions. Actin was used as the internal reference gene, and the relative expression level was calculated by the 2−ΔΔCt method.
7
Quantitative Real-Time PCR Protocol for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from LX-2 cells and liver tissues using the RNAiso kit (TianGen, China) following the manufacturer’s instructions. Total RNA was reverse-transcribed to cDNA using the Primer Script™ RT Master Mix kit (Takara, Japan). Then, qRT-PCR was performed using the SYBR ® Premix Ex Taq™II (2×) mix (Takara, Japan) using a CFX 96-type RT fluorescence quantitative PCR instrument (Bio-Rad, Hercules, CA, USA). GAPDH was used as a reference gene. Cycle thresholds were determined for each sample and each gene amplification. Based on the 2−ΔΔCt method, relative target gene expression was calculated. Primer sequences for the mouse and cell-based experiments are shown in Table 2 . The PCR procedure was an initial 30 s hold at 95 °C, then 40 repeated cycles of step 1 at 95 °C for 5 s, step 2 at 60 °C for 20 s, and step 3, melting (65–95 °C depending on the primer melting temperature) at 2.2 °C/s.
8
Quantifying lncRNA-LET Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissues and cells was extracted using a MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China). RNA was reverse-transcribed into cDNA using a Primer-Script™ RT Master Mix kit (TaKaRa, Dalian, China). The cDNA template was amplified by real-time PCR using a SYBR Premix Ex Taq™ IIkit (TaKaRa, Dalian, China). Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) was used as an internal control, and lncRNA-LET values were normalized to GAPDH. RT-PCR reactions were performed using the CFX96 Touch system (Bio-Rad, USA). The relative expression of mRNAs was calculated using the 2-∆∆Ct methods. The primer sequences were as follows: GADPH: 5’GTCAACGGATTTGGTCTGTATT-3’ (forward), 5’-AGTCTTCTGGGTGGCAGTGAT-3’ (reverse); lncRNA-LET: 5’-CCTTCCTGACAGCCAGTGTG-3’ (forward), 5’-CAGAATGGAAATACTGGAGCAAG-3’ (reverse).
9
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells or tissues were extracted with TRIzol reagent and RNeasy Mini Kit (Qiagen), and were subsequently reverse transcribed into cDNA by PrimerScript™ RT Master Mix Kit (Takara). RNA quantitation was performed with TB Green Premix EX Taq kit (Takara) on the ABI QuantStudio6 system according to manufacturer’s protocol. The primers used for amplification of DANCR are listed in Supplementary Table 2 .
10
Quantification of miRNA and Cytokine Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The treated cells were harvested and incubated with TRIzol reagent (Invitrogen, China). Total RNA was extracted from these cells and 1.0 µg of RNA was directly utilized for reverse transcription into cDNA by PrimerScript RT Master Mix kit (Takara, Dalian, China) following the manufacturer’s instructions. The resultant cDNA was analyzed by qPCR using SYBR Green Universal Master mix (Roche Diagnostics). All primers utilized in the study were acquired from Sangon Biotech (Shanghai). U6 and GAPDH were utilized as the internal controls to normalize the Ct values for miR-155-5p and the inflammatory cytokine receptors, respectively, to determine their relative expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!