Hfx. mediterranei DSM1411 was cultivated in a 3 L-bioreactor (Diachrom Biotechnology, Figure S1 ). pH value (7.2 ± 0.01) and temperature (37 ± 0.1 °C) were automatically controlled. According to the results obtained from the in-batch trials, fermentation was carried out for 120 h. The cultivation was carried out in constant airflow rate of 1 vvm (volume of air per volume of reactor per minute) and oxygen partial pressure of about 20% of air saturation (controlled by stirring variation from 300 to 600 rpm) to guarantee aerobic condition. Foaming was inhibited by the automatic addition of Antifoam A (Sigma, Milano, Italy). CDM and PHBV were determined as mentioned above. Each experimental condition was obtained and analyzed in three replicates.
Antifoam a
Manufactured by Merck Group
Sourced in United States, Italy
Antifoam A is a silicone-based defoaming agent developed by Merck Group. It is designed to suppress and prevent the formation of foam in various industrial processes and applications.
Automatically generated - may contain errors
Lab products found in correlation
Hydroxypropyl cellulose, by Merck Group (2 mentions)
1 ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride edc, by Thermo Fisher Scientific (2 mentions)
Tris 2 carboxyethyl phosphine hydrochloride solution tcep, by Merck Group (2 mentions)
6 maleimidohexanoic acid, by Merck Group (2 mentions)
Sodium hydroxide (naoh), by Merck Group (2 mentions)
Methanol, by Merck Group (2 mentions)
Formaldehyde, by Merck Group (2 mentions)
Silver nitrate, by Merck Group (2 mentions)
N hydroxysuccinimide, by Merck Group (2 mentions)
Biostat b plus, by Sartorius (2 mentions)
Triton x 100, by Merck Group (2 mentions)
5m naoh, by Merck Group (2 mentions)
2 m hcl, by Merck Group (2 mentions)
Pyrrole 2 carboxylic acid, by Merck Group (1 mentions)
Dimethyl sulfoxide d6, by Merck Group (1 mentions)
Dichloromethane, by Merck Group (1 mentions)
Cysteamine, by Merck Group (1 mentions)
2 furanmethanethiol, by Merck Group (1 mentions)
Isopropanol, by Merck Group (1 mentions)
Reax top, by Heidolph (1 mentions)
17 protocols using antifoam a
1
Optimized Hfx. mediterranei Bioproduction
2
Nebulization of MS2 Bacteriophage Aerosols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four 6-Jet Collison Nebulizers (part no. ARGCNB3, CH Technologies, Westwood, NJ) were used to aerosolize MS2 during each experiment, with two pairs of nebulizers operating in opposite corners of the chamber in front of the mixing fans (Fig. 1 A). A 10 mL mixture of 1:4 parts MS2 stock (thawed at room temperature and vortexed until no crystals remain) to 0.22 μm filter-sterilized deionized water with 6 drops of Antifoam A (Sigma-Aldrich, St. Louis, MO) was added to each nebulizer. An inoculum concentration check was performed for each test by enumerating both the inoculum before it was divided into the nebulizers and the inoculum from each nebulizer. Each nebulizer was outfitted with a polycarbonate precious fluids jar (part no. ARGJAR0002, CH Technologies, Westwood, NJ) and a precious fluids extension sleeve. (part no. ARGCNB0038, CH Technologies, Westwood, NJ). MS2 was aerosolized over a 10-min period using dried compressed air at 40 psi with a flow rate of 20 L per minute and approximately 0.28 mL of fluid distributed per minute at each nebulizer.
3
Photoactivated Biofunctionalization of Surfaces
4
Sustainable PHBV Production from Wasted Bread
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wasted bread substrate considered suitable for the PHBV sustainable production was chosen according to the bioplastic yield and the lowest use of additional input. It corresponded to the 15% wasted bread homogenate obtained without enzymatic treatment and incubated for 1 h at 4°C, mixed with microfiltered seawater in the ratio 40:60, sterilized at 121°C for 15 min, filtered with MF-Millipore membrane filter, added with 160 g/L of NaCl, and adjusted to pH 7.2 with 1M ammonia solution.
Such substrate was prepared and fermented with Hfx. mediterranei DSM1411 in a 3 L-bioreactor (Diachrom Biotechnology, Switzerland) with automatic control of pH and temperature, which were set at values of 7.2 ± 0.01 and 37 ± 0.1°C, respectively. Fermentation lasted 72 h and it was carried out under controlled stirring at 400 rpm, using half of the available volume of the bioreactor, to promote aerobic conditions. Foaming was inhibited by the automatic addition of Antifoam A (Sigma, Milan, Italy). At the end of the incubation, the cells were recovered as described above.
Such substrate was prepared and fermented with Hfx. mediterranei DSM1411 in a 3 L-bioreactor (Diachrom Biotechnology, Switzerland) with automatic control of pH and temperature, which were set at values of 7.2 ± 0.01 and 37 ± 0.1°C, respectively. Fermentation lasted 72 h and it was carried out under controlled stirring at 400 rpm, using half of the available volume of the bioreactor, to promote aerobic conditions. Foaming was inhibited by the automatic addition of Antifoam A (Sigma, Milan, Italy). At the end of the incubation, the cells were recovered as described above.
5
Nanopore DNA Hybridization Experiment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hybridization experiment was realized using a hybridization solution (HB) which contains 50% formamide, 5× SSC (0.75 M sodium chloride, 75 mM sodium citrate), 0.5% SDS, 5 mM potassium phosphate, and 2 μL antifoam A (Sigma-Aldrich, St. Louis, MO, USA) at pH 7.2. It has a measured conductivity of approximately 6 S.m−1. The aqueous solutions of perfectly complementary (PC) (0.2 nM) and non-complementary (NC) (0.2 nM) sequences were prepared in carbonic acid buffer solution. A nanopore containing a single-stranded DNA-modified channel was mounted on the conductivity cell. To achieve DNA hybridization, the DNA-modified channel was exposed to NC and PC solutions for 5 h at 30°C. DNA molecules used in our experiments for functionalization and translocation are listed in Table 1 .
| Probe | 5′-TTTTTTTTTTTTGTCATTATGTGCTGCCATATCTACTTCAGA-3′ sequence |
| Perfectly complementary (pc-DNA) | CGTAGGTACTCCTTAAAGTTAGTATTTTTATATGTAGTTTCTGAAGTAGATATGGCAGCACATAATGACATATTTGTACTGCGTGTAGTATCAACAACAGTAACAAA |
| Non-complementary (nc-DNA) | ACATGTCTTATATATTCTTTAAAATTTTCATTTTTATATGTACTGTCACTAGTTACTTGTGTGCATAAAGTCATATTAGTACTGCGAGTGGTATCTACCACAGTAACAAA |
6
Respiratory Function Assessment of Macaques
7
Synthesis of FAM-tagged miR148b Oligonucleotides
8
Co-culture of P. citronellolis and C. necator
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
P. citronellolis NRRL B-2504 and C. necator DSM 428 were co-cultured in a bioreactor with a working volume of 10 L (BioStat B-Plus, Sartorius, Germany), with a starting volume of 9.5 L. The cultivation runs were initiated by inoculating 400 mL of each culture grown in LB medium for 24 h, at 30 °C and 200 rpm, in an orbital shaker.
The temperature and the pH were controlled at 30.0 ± 0.1 °C and 7.00 ± 0.02, respectively. The pH was controlled by the automatic addition of 5 M NaOH (98%, Sigma-Aldrich, USA) or 2 M HCl (37%, Sigma-Aldrich, USA). A constant air flow rate (4 SLPM, standard liters per minute) was kept during the cultivation runs and the dissolved oxygen concentration (DO) was controlled at 30% of the air saturation by the automatic adjustment of the stirring speed (300–800 rpm). Foam formation was suppressed by the automatic addition of Antifoam A (Sigma-Aldrich, USA). The bioreactor was operated under a batch mode during 48 h. Samples (24 mL) were collected from the bioreactor for biomass, PHA, and nutrient quantification.
A bioreactor cultivation was also performed, under similar conditions, with a monoculture of C. necator for comparison.
The temperature and the pH were controlled at 30.0 ± 0.1 °C and 7.00 ± 0.02, respectively. The pH was controlled by the automatic addition of 5 M NaOH (98%, Sigma-Aldrich, USA) or 2 M HCl (37%, Sigma-Aldrich, USA). A constant air flow rate (4 SLPM, standard liters per minute) was kept during the cultivation runs and the dissolved oxygen concentration (DO) was controlled at 30% of the air saturation by the automatic adjustment of the stirring speed (300–800 rpm). Foam formation was suppressed by the automatic addition of Antifoam A (Sigma-Aldrich, USA). The bioreactor was operated under a batch mode during 48 h. Samples (24 mL) were collected from the bioreactor for biomass, PHA, and nutrient quantification.
A bioreactor cultivation was also performed, under similar conditions, with a monoculture of C. necator for comparison.
9
Optimized Particle Extraction from Filters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Collected particles were extracted from SASS and Bobcat filters with a common manual filter extraction procedure. Liquid extraction was done by removing the filters from their housing and transferring them into 50 ml polypropylene vials pre-loaded with 10 ml PBSTA, PBS with 0.05% Triton X-100 (Sigma-Aldrich, St. Louis, MO, USA) and 0.005% Antifoam A (Sigma-Aldrich). The vial was shaken by hand to wet the filter and then vortexed (Reax Top, Heidolph Instruments, Schwabach, Germany) at maximum speed for 20 s. Sterile forceps was use to transfer the filter into a 10 ml syringe to extract residual liquid in the filter back into the vial before discarding the filter. The gelatin reference filter was transferred to a 50 ml polypropylene vial pre-loaded with 20 ml PBSTA and dissolved by incubating in water bath at 37 °C for 15 min. The manual extraction protocols have been optimized to produce maximized generic biomass recovery from electret and gelatin filters with demonstrated recovery efficiencies close to 100% (data not shown).
10
Concentration and Detection of Bacterial Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each water microcosm was concentrated by dead-end ultrafiltration, implementing a methodology developed by the EU project AQUAVALENS. The complete sample (20 L) was filtered through a Rexeed 25A (Asahi-Kasei, Japan) hollow fibre filter with pore size of 30 kDa. The retentate of each sample was back flushed from the filter using 500 mL of a sterile 0.001% Antifoam A, 0.01% Sodium Polyphosphate and 0.01% Tween 80 (Sigma Aldrich) solution. Beef extract (Sigma Aldrich) and a solution of 5X Polyethylene Glycol 8000 and NaCl (Sigma Aldrich) were added to each eluate to a final concentration of 13.33 g/L and 333.33 mL/L, respectively. The mixture was incubated overnight at 4 °C and centrifuged at 10,000× g for 30 min at 4 °C. Pellets were resuspended in PBS with 0.001% Antifoam A and 0.01% Tween 80. One mL of each pellet was preserved at −80 °C for DNA extraction. Enumeration of E. coli Lys9 StrepR and L. innocua ATCC 51742 StrepR and enrichment for the detection of both strains in the concentrated samples were performed as described above for the detection of both species in lettuce samples. For enriched samples, the value of 0.5 cfu per 1 mL of concentrated sample was assumed, corresponding to one colony detected over two plates on a 100 dilution, with the limit of quantification calculated based on the volume of the pellet after sample concentration.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!