Precision melt supermix

High-resolution melting (HRM) analyses were performed on PCR clones of undigested DNA from T2 seedlings of wild-type lines Cas9-CRU #2 and Cas9-PPO #7 using Precision Melt Supermix (Bio-Rad), containing EvaGreen saturated dye, and the Bio-Rad C1000 Touch thermal cycler (Bio-Rad). Melt curves were analyzed using the Bio-Rad Precision Melt Analysis software. For the CRU target primers SP492 and SP563 were used and for the PPO target primers SP560 and SP561 (Table S2). Samples with various melt curves were sequenced by Macrogen Europe (Amsterdam, The Netherlands).

To assess FOXP3 Treg-specific demethylated region (TSDR) hypomethylation, genomic DNA was extracted from cell pellets using the DNeasy Blood and tissue kit (#69506, Qiagen, USA), DNA bisulfite conversion was done using the Epitech Fast Bisulfite Conversion Kit (#59826, Qiagen, USA), and FOXP3 TSDR hypomethylation was then assessed by qPCR high-resolution melting curve analysis using Precision Melt Supermix (#1725112, Biorad, France) and FOXP3 TSDR-specific primers (forward: TTGGGTTAAGTTTGTTGTAGGATAG, reverse: ATCTAAACCCTATTATCACAACCCC, Sigma Aldrich, France). The fragment analyzed included 11 CpG sites and total TSDR methylation was calculated as the mean of methylation percentage of each individual CpG. Methylation levels were determined using a standard curve (#59695, Qiagen). For CAR-Treg products manufactured from leukapheresates of female donors, raw values were corrected to consider that one of the two TSDR alleles is fully methylated as a result of X-inactivation.

The frequency of reassortant viruses was determined as described previously [35 (link)]. Plaque assays were performed in 10 cm-diameter dishes to isolate viral clones and agar plugs were collected with 1 mL serological pipettes into 160 μl PBS. vRNA was extracted using the Quick RNA 96 extraction kit (Zymo) then reverse transcribed using Maxima reverse transcriptase (Thermofisher) per the manufacturer’s instructions using the Universal F(A)+6 primer (gcgcgcagcaaaagcagg). cDNA was diluted 1:4 in nuclease-free water and combined with segment-specific primers [7 (link)] to differentiate WT and VAR segments by high-resolution melt analysis with Precision Melt Supermix (Bio-Rad) using a CFX384 Touch Real-time PCR detection system (Bio-Rad) and BioRad CFX Manager 3.1 software. Data were analyzed using Precision Melt Analysis 1.3 software (Bio-Rad) to assign a genotype based on the combination of WT and VAR segments in each isolate. Percent reassortment was calculated as the number of viral isolates with any reassortant genotype divided by the number of isolates screened, multiplied by 100. Results were plotted as a function of percent HA+ cells as determined by flow cytometry. Semi-log curves were fitted to the data in Graphpad.

To assess sgRNA efficiency in vivo, 100 embryos were injected with a Cas9-gRNA mixture. Of these 24 hatched and their genomic DNA and that of three wild-type Orlando larvae were individually extracted by DNeasy Tissue and Blood Kit (Qiagen, Hilden, Germany). The concentration and purity of genomic DNA was measured in a Nanodrop 2000 spectrophotometry (Thermo Fisher Scientific, Waltham, MA, USA). High resolution melt analyses were performed by Precision Melt Supermix (Bio-Rad, Hercules, CA, USA) using optimized forward (GTACTAACTCAACTTTATGGC) and reverse (GGCATTTTCCCCCCAACCTG) primers. In 10μL reaction was included with 1 μL of primer (2 μM), 4 μL of genomic DNA (50 ng) and 5 μL of Precision Melt Supermix. Real time PCR was run in Bio-Rad’s CFX 96 under the following conditions: one cycle of 95 C, 2 min; 40 cycles of 95 C, 10 sec, 60 C, 30 sec and 72 C, 30 sec; 1 cycle of 95 C, 30 sec, 60 C, 1 min and 65–95 C in 0.2 C increments, 10 sec/step. The generated data files were imported into Precision Melt Analysis software for HRM analysis based on the thermal denaturation properties of double-stranded DNA. The normalized melt curves were grouped with the wild-type samples as references.

For genomic DNA extraction, two frozen leaf discs from pinto beans were ground with metal beads in a MM300 Mixer Mill tissue disrupter (Retsch) and DNA was extracted using a conventional cetyl‐trimethylammonium bromide (CTAB) method (Murray & Thompson, 1980). DNA was quantified with a NanoDrop 1000 spectrophotometer (ThermoFisher Scientific). High‐resolution melt‐curve (HRM) analysis was performed to separate the SD and RD lines of pinto bean cultivars using Precision Melt Supermix (Bio‐Rad) with the gene region‐specific primers to detect SNP or 3 bp deletion (InDel; Table S2). The CFX96 Touch Real‐Time PCR Detection System (Bio‐Rad) was precalibrated using the Melt Calibration kit (Bio‐Rad). Samples were run using 95°C for 2 min to activate the hot‐start polymerase, followed by 40 cycles of 95°C for 10 s and 56.5°C for 30 s. For HRM analysis, PCR products were subjected to the following steps: 95°C for 30 s, 60°C for 1 min, and then temperature increase from 65°C to 95°C with a ramp rate of 0.2°C/s. Melt curves were generated and analyzed using Precision Melt Analysis Software 1.3 (Bio‐Rad).

50–60 bp amplicons containing CRISPR sites were created using genomic DNA as template and the following primers:
tpc2 –F 5′-TGGTGGGATGGCGGCAGA-3′
R 5′-GCCACTGCCTCGGTCCCG-3′
Amplicons were screened for random mutations using real-time PCR (Bio-Rad CFX96) with Precision Melt Supermix (Bio-Rad) according to manufacturer’s instructions.