Levels of mRNA expression were analyzed by RT-PCR assay using total RNA isolated from lung tissues or NHBE cells by a rapid extraction method (TRI-Reagent) as previously described 24 (link). RNA was quantified by measuring absorption at 260 nm and was stored at -70ºC until use. One μg of total RNA was reverse-transcribed to cDNA using transcriptor first strand cDNA synthesis kit (Roche Diagnostics, Basel, Switzerland). The primers used were as follows: GRP78, sense: 5′-GAAAGGATGGTTAATGATGCTGAG-3′, antisense: 5′-GTCTTCAATGTCCGCATCCTG-3′; CHOP, sense: 5′-CATACACCACCACACCTGAAAG-3′, antisense: 5′-CCGTTTCCTAGTTCTTCCTTGC-3′; IL-17A, sense: 5′-CCCCTAGACTCAGGCTTCCT-3′, antisense: 5′-TCAGCTCCTTTCTGGGTTGT-3′; β-actin, sense: 5'-CAGATCATGTTTGAGACCTTC-3', antisense: 5'-ACTTCATGATGGAATTGAATG-3' and GAPDH, sense: 5′-GGCCTCCAAGGAGTAAGACC-3′, antisense: 5′-AGGGGTCTACATGGCAACTG-3′. PCR reactions were performed in a thermal cycler (MJ mini, Bio-Rad Laboratories, Hercules, CA, USA). The amplified PCR products were electrophoresed using 1.6% agarose gels stained with ethidium bromide. DNA bands were visualized using Gel Doc XR+ Imaging System (Bio-Rad Laboratories). The results were expressed as a relative ratio of the target intensity to intensity of β-actin or GAPDH. The relative ratio of the target intensity of SV mice or control group is arbitrarily presented as 1.
Mj mini
Manufactured by Bio-Rad
Sourced in United States
The MJ Mini is a compact thermal cycler designed for DNA amplification. It has a 48-well sample block and is capable of performing polymerase chain reaction (PCR) experiments. The MJ Mini features a simple user interface and is intended for basic PCR applications in the laboratory.
Automatically generated - may contain errors
Lab products found in correlation
Abi prism 3130xl, by Thermo Fisher Scientific (2 mentions)
Gel doc xr imaging system, by Bio-Rad (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Facscalibur, by BD (1 mentions)
Las 3000 luminescent image analyzer, by Fujifilm (1 mentions)
Z1 inverted microscope, by Zeiss (1 mentions)
Imagequant las 4010, by GE Healthcare (1 mentions)
Digital analyzer, by NanoString (1 mentions)
Ncounter prep station, by NanoString (1 mentions)
Capture probeset, by NanoString (1 mentions)
Genemapper v4, by Thermo Fisher Scientific (1 mentions)
Abi prism 310 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sypro orange, by Thermo Fisher Scientific (1 mentions)
Jem 1230 electron microscope, by JEOL (1 mentions)
Zetasizer nano zs instrument, by Malvern Panalytical (1 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Gotaq dna polymerase, by Promega (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
35 protocols using mj mini
1
RT-PCR Quantification of mRNA Levels
2
Detailed Research Equipment Specifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Spectrophotometer Zenyth 200 (ELISA reader) was from Anthos (Eugendorf, Austria).
The Kinematica Polytron was from Brinkmann Instruments (Westbury, NY, USA).
The flow cytometer used was the FACSCalibur, including its software, from Becton Dickinson (Mountain View, CA, USA).
The Elisa reader Ceres UV 900 was from Bio-Tek (Burlington, VT, USA).
The β-counter, a 1600 CA Tri-Carb liquid scintillation analyzer, was from Packard (Meriden, CT, USA).
Surgery equipment was from Bar Naor (Ramat-Gan, Israel).
The densitometric apparatus was ImageQuant LAS 4010 (GE Health Care Life Sciences, Rehovot, Israel).
Thermal cycler (MJ Mini, Bio-Rad Laboratories, Rishon Le Zion, Israel).
E-Gel PowerBase apparatus (Invitrogen, Life Technologies, RHENIUM, Modi'in, Israel)
LAS-3000 luminescent image analyzer (Fujifilm, Tokyo, Japan).
Hamilton–Kinder sensor in a soundproof ventilated apparatus (Kinder Scientific, Poway, CA, USA).
Z1 inverted microscope (Zeiss, Oberkochen, Germany).
3
NanoString Gene Expression Analysis
4
Genotyping of CILP and ASPN Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from the buccal cells of the athletes using cotton swabs. The CILP polymorphism was performed as described in our previous study.4 (link) The ASPN D-repeat polymorphism was genotyped by fragment size. The D-repeat region was amplified using the forward primer 5′-TCCTAGACTGGTCTTCTACACT-3′ and the reverse primer 5′-TCTGAGCAATGTACAACTCGTG-3′. The forward primer was 5′ labeled with FAM. The polymerase chain reaction (PCR) cycling reactions, using a thermal cycler (MJ Mini, BioRad, Hercules, CA), were performed at 94°C for 10 minutes, 30 cycles at 94°C for 30 seconds, at 64°C for 30 seconds, and at 72°C for 30 seconds, followed by one cycle at 72°C for 10 minutes. After amplification, the alleles were discriminated using the ABI PRISM 310 genetic analyzer (Applied Biosystems, Foster City, CA) and the fragment analysis GeneMapper V4.0 software (Applied Biosystems).
5
Genotyping of GJB2 Gene Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from the blood leukocyte fraction using the phenol-chloroform method. Amplification of non-coding (exon 1), coding (exon 2) and flanking intronic regions of the GJB2 gene was conducted with PCR on a MJ Mini (Bio-Rad) thermocycler using primers 5'-CCGGGAAGCTCTGAGGAC-3' and 5'-GCAACCGCTCTGGGTCTC-3' for amplification of exon 1 [55 (link)] and 5'-TCGGCCCCAGTGGTACAG-3' and 5'-CTGGGCAATGCGTTAAACTGG-3' for amplification of exon 2 [32 (link), 58 (link), 59 (link)]. The PCR products were subjected to direct sequencing using the same primers on ABI PRISM 3130XL (Applied Biosystems, USA) Genomics Core Facility, Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia). DNA sequences variations were identified through comparison with the GJB2 gene reference sequences М86849.2 and U43932.1 (GenBank).
6
RNA Extraction and RT-PCR for Viral Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the serum samples using TRIzol Reagent (Invitrogen), and suspended in 20 μL of ultrapure water, following the manufacturer’s recommendations. RT-PCR was carried out in a 50 μL reaction mixture containing 1× RT-PCR buffer (TAKARA, Bio, Inc.), 20 pM of Panpesti generic primers targeting 5′-UTR, 2 U of one-step Enzyme Mix (TAKARA, Bio, Inc.) and 4 μL of RNA for the expected product sizes of 290 bp [27 (link)], the reaction was run in a thermocycler (Mjmini, BIO-RAD) according to the following program: reverse transcription at 50 °C for 30 min, denaturation at 95 °C for 5 min, 35 cycles at 94 °C for 30 s, 54 °C for 30 s and 72 °C for 45 s, and termination with a final extension of 10 min at 72 °C. The amplification products were electrophoresed in 2 % agarose gels. Part of the interesting Npro genes were amplified as the same method and the primer sequences were as followed: N1F: ATGGAGTTGATTTCAAATGAACT; N504R: GCAGCTTGAAACCCATAGAG, the expected product was 504 bp.
7
ISSR Amplification of Polymorphic DNA Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ISSR reactions were performed in a volume of 50 μL containing 25 ng of template DNA, 10X PCR buffer (10 mmol/L of Tris HCl, pH 8.3; 50 mmol/L of KCl2), 2.5 mmol/L of MgCl2, 0.2 mmol/L of each dNTP, 0.4 μmol/L primer and 2 U of Taq DNA polymerase, by means of a thermal cycler (MJ-Mini, BioRad, USA). PCR amplification was performed as follows: initial denaturation at 95 °C for 7 min, followed by 45 cycles at 95 °C for 30 s, 48 °C–60 °C for 45 s and 72 °C for 90 s and a final 10 min extension at 72 °C. Amplification products were separated by electrophoresis in 1.5% agarose gels. A total of 100 primers (ShengGong Biotechnology Inc, CHN) were used in the PCR programme, and as a result, 15 primers that amplified polymorphic bands were selected. The sequences of the 15 primers are shown in Table 2 .
8
SYPRO Orange Thermal Shift Assay for Nucleosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DSF analysis was performed on a Bio-Rad MJ Mini real-time PCR machine using the Opticon Monitor 3 software. For the analysis 23 μl of 2.5 μM nucleosome in 10 mM NaHPO4, pH 7.5, 1 mM EDTA, 150 mM NaCl and 2 μl of 25 × SYPRO Orange (diluted from 5,000 × Concentrate in DMSO; Life technologies S-6650) were added into a real-time PCR plate and sealed with transparent film. Then the sample was first kept for 1 min at 15 °C and then heated from 15–95 °C in 1 °C steps with one minute at each temperature. Fluorescence was read out for each temperature. The data was analysed using the excel sheets described by Niesen et al.18 (link) Melting temperatures were extracted by fitting using a Boltzmann sigmoidal function in OriginPro. Reported are the fitted parameter including the s.e.m.
9
Characterization of Chimeric Cytomegalovirus Virus-Like Particles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The concentration of purified CMVTT was estimated using the QuBit fluorometer in accordance with manufacturer’s recommendations (Invitrogen, Eugene, USA). Concentrated VLP solutions (approximately 3 mg/ml) were stored at+ 4 oC in 5 mM sodium borate, 2 mM EDTA, buffer (pH 9.0). To demonstrate the presence of tetanus epitope in CMV VLPs, the mass spectrometric analysis of the purified CMVTT (also referred to as CMV-Ntt830) VLPs was used. The stability of VLPs was investigated by thermal denaturation in the presence of SYPRO-orange dye using a DNA melting point determination program and a real-time PCR system MJ Mini (Bio-Rad, Hercules, USA). This involved subjecting VLP samples to increasing heat whilst monitoring fluorescence. The morphology of VLPs was confirmed by applying samples (0.1–0.5 mg/mL) on glow discharged carbon coated copper grids and observing by transmission electron microscopy using JEM-1230 electron microscope (JEOL, Tokyo, Japan). Average sizes of VLP preparations were determined by dynamic light scattering, assessed by diluting to 1 mg/ml and analyzing in Zetasizer Nano ZS instrument (Malvern Instruments Ltd, Malvern, UK).
10
Quantitative Analysis of Adenosine Receptor Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!