Two step reverse transcription kit

Total RNA was extracted from HCC cell lines using an RNAIsoPlus assay kit (Takara, Dalian, China) according to the manufacturer’s instructions. After quantification, RNA was transcribed into cDNA using a two-step reverse transcription kit (Takara, Dalian, China). Subsequently, qPCR was used to detect target gene expression levels using the SYBR-Green qPCR master mix (Takara, Dalian, China). The thermocycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 35 cycles of a two-step PCR of 95°C for 14 s and 60°C for 1 min. The 2^ΔΔCq method was used to quantify the results; the relative expression level of AQP3 was normalized to that of GAPDH. The primers used were as follows: AQP3, forward (F), 5ʹ–GGCTGTATTATGATGCAATCT–3ʹ and reverse (R), 5ʹ–ATATCCAAGTGTCCAGAGG–3ʹ. GAPDH F, 5ʹ–GATCATCAGCAATGCCTCCT–3ʹ and R, 5ʹ–GAGTCCTTCCACGATACCAA–3ʹ. The data have been deposited in a publicly accessible database (GenBank) with accession number NM_004925.5 and NM_002046.7 for AQP3 and GAPDH, respectively.

RNAiso Plus kit (Takara Biotechnology Co., Ltd., Dalian, China); Two-Step Reverse Transcription kit (Takara Bio, Inc., Otsu, Japan); SYBR-Green qPCR Master Mix kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA); UV spectrophotometry instrument (Bio-Rad Laboratories, Inc., Hercules, CA, USA); RT-qPCR kit and StepOnePlus real-time PCR instrument (both from Thermor Fisher Scientific, Inc.).