Total RNA was extracted from colon tissue using RNAiso Plus (TAKARA, JAPAN) according to the manufacturer’s instructions. Then 1 μg RNA was extracted for reverse transcription synthesis reaction. The complementary DNA (cDNA) was synthesized with transcript all-in-one first-strand cDNA synthesis supermix for qPCR (Transgene, Beijing). The cDNA was diluted with 1:10, and then 1 μl was used for each qPCR. The qPCR was performed using SYBR Green reagent (Applied Biosystems, CA, U.S.A.) on a Step-One Real-Time PCR System (Applied Biosystems) with the following specific gene primers were prepared for Aryl hydrocarbon receptor (AHR): Forward Prime 5′-TCGGGGTACC AGTTCATCCA-3′, Reverse Prime 5′-ACCTCCAGCGACTGTGTTTT-3′. The qPCR conditions were set to 40 cycles of 95°C for 20 s, 95°C for 30 s, and 60°C for 30 s. The GAPDH was chosen as a housekeeping gene for each experiment. The relative expression was calculated using the formula 2−ΔΔCt for analysis.
Transcript all in one first strand cdna synthesis supermix for qpcr
Manufactured by Transgene
Sourced in China
Transgene's Transcript all-in-one first-strand cDNA synthesis supermix for qPCR is a complete solution for the reverse transcription and real-time PCR amplification of target RNA sequences. It includes all the necessary components for the synthesis of cDNA from total RNA and the subsequent qPCR reaction in a single convenient mix.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Sybr green reagent, by Thermo Fisher Scientific (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Chamq sybr qpcr master mix 2, by Vazyme (1 mentions)
Rapure total rna kit, by Magen Biotechnology Co (1 mentions)
Perfectstart green qpcr supermix, by Bio-Rad (1 mentions)
Cfx maestro, by Bio-Rad (1 mentions)
Transstart tip green qpcr supermix kit, by Transgene (1 mentions)
Transstart tip green qpcr supermix, by Transgene (1 mentions)
6 protocols using transcript all in one first strand cdna synthesis supermix for qpcr
1
Quantifying AHR Expression in Colon Tissue
2
RNA Reverse Transcription Optimized
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA reverse transcription were performed with the Transcript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech, Beijing, China), according to manufacturer’s specifications. Briefly, the total RNA was reverse-transcribed in a final volume of 20 μl that contained 1 μg RNA, 4 μl of 5 × Transcript All-in-One SuperMix for qPCR, 1 μl of gDNA Remover and 14 μl RNase-free water. The reaction mix was incubated at 42 °C for 15 min, and the reverse transcriptase was inactivated by heating at 85 °C for 5 s. All cDNA samples were stored at −80 °C until analysis.
3
Quantifying Inflammatory Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using the RaPure Total RNA kit (Magen), which was used to generate cDNA by using TranScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (TransGen Biotech). qPCR was performed using the Bio-Rad sequence system CFX96 with ChamQ™ SYBR® qPCR Master Mix (2×) (Vazyme) as recommended by the manufacturer. The primers used were as follows: IL-6F: 5′-TCCAGTTGCCTTCTCCC-3′, R: 5′-GCCTCTTTGCTGCTTTC-3′; MIF F: 5′-CGCAGAACCGCTCCTACA-3′, R: 5′-GAGTTGTTCCAGCCCACATT-3′.β-actin (F: 5′- CATCCGCAAAGACCTGTACG-3′, R: 5′- CCTGCTTGCTGATCCACATC-3′) was used as the internal control. qPCR results were analyzed and converted to fold changes.
4
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Thermo Fisher Scientific). First-strand cDNA was synthesized from total RNA using Transcript All-in-One First-strand cDNA Synthesis SuperMix for qPCR (TransGen, Beijing, China). RT-qPCR was performed using PerfectStart Green qPCR SuperMix on CFX Maestro (Bio-Rad Laboratories, Hercules, CA, USA), with GAPDH as an internal loading control. The Bio-Rad CFX Maestro real-time monitoring system was used according to the manufacturer's instructions. Relative levels were calculated by the relative quantification 2^(-ΔΔCT) method. The mean value of the relative mRNA expression in the control samples was set to 1. Primers were purchased from Sangon Biotechnology Co., Ltd. (Beijing, China), and their sequences are listed in Table 1 .
Primer sequences were used in this study
| Genes | Forward primer sequence | Reverse primer sequence |
|---|---|---|
| PARVB | TGGACTCAATTCACGGGAAGA | GCACCGTTACATGCTCAGGA |
| S100A9 | CAACACCTTCCACCAATACTCT | AGGTCCTCCATGATGTGTTCT |
| CXCL2 | CCGAAGTCATAGCCACACTCA | TGGATTTGCCATTTTTCAGCATCT |
| SPP1 | GAAGTTTCGCAGACCTGACAT | GTATGCACCATTCAACTCCTCG |
| LYZ | GGCCAAATGGGAGAGTGGTTA | CCAGTAGCGGCTATTGATCTGAA |
| HIF1A | ATCCATGTGACCATGAGGAAATG | TCGGCTAGTTAGGGTACACTTC |
| CDH1 | ATTTTTCCCTCGACACCCGAT | TCCCAGGCGTAGACCAAGA |
| PPARGC1A | GCTTTCTGGGTGGACTCAAGT | GAGGGCAATCCGTCTTCATCC |
| GAPDH | CTGGGCTACACTGAGCACC | AAGTGGTCGTTGAGGGCAATG |
5
Comparative Analysis of LuxS in Probiotic Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The strains L. acidophilus , L. bulgaricus , and S. thermophilus (1:1:1) were inoculated in the MRS medium at 37°C for 18h. The RNA samples of the cells were then collected using a Magen kit (Magen Biotech Co. Ltd., Guangzhou, China). After that, the extracted RNA was reverse transcribed with the kit (TranScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR, TransGen Biotech, Beijing, China) for qPCR analysis with the internal reference gene was dp3d (DNA polymerase III, delta subunit). Gene-specific primers were forward (5′-GAATGTGGGCGTTAAGCAAACC -3′) and reverse (5′-TGCACGTTCCTCATCACTATCG -3′).
Gene-specific primers of the LuxS in different strains were as follows.L. bulgaricus , forward (5′-CACACCATTGAACACCTCCTG -3′), reverse (5′-TGTCGTCTCTGATTGCCTTGA -3′); S. thermophilus , forward (5′-TTTGGTTGCCGTACAGGTTTCC -3′), reverse (5′-GCTGAATGAAGGCTGTGATCCT -3′); and L. acidophilus , forward (5′-CCTACCGGCGGATTGCATACTA -3′), reverse (5′-ATCCTGTTCGGCAACCAAATGG -3′).
qPCR analysis was carried out in triplicate with the TransStart Tip Green qPCR SuperMix kit (TransGen Biotech, Beijing, China), and the number of cDNAs were normalized to the abundance of dp3d by the 2-△△CT method. The relative quantitative method was used for LuxS signaling molecule gene analysis.
Gene-specific primers of the LuxS in different strains were as follows.
qPCR analysis was carried out in triplicate with the TransStart Tip Green qPCR SuperMix kit (TransGen Biotech, Beijing, China), and the number of cDNAs were normalized to the abundance of dp3d by the 2-△△CT method. The relative quantitative method was used for LuxS signaling molecule gene analysis.
6
Quantitative Analysis of LuxS Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The strains L. acidophilus, L. bulgaricus and S. thermophilus (1:1:1) were inoculate in the MRS medium at 37 ℃ for 18h. Then, the cells were collected for the RNA extraction using Magen kit (Magen Biotech Co.,Ltd., Guangzhou, China). After that, the extracted RNA was reverse transcribed with the kit (TranScript All-in One First-Strand cDNA Synthesis SuperMix for qPCR, TransGen Biotech, Beijing, China) for real-time PCR analysis with the internal reference gene is dp3d (DNA polymerase Ⅲ, delta subunit).
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Gene-specific primers F (5'-GAATGTGGGCGTTAAGCAAACC-3'), R (5'-TGCACGTTCCTCATCACTATCG-3'). Use the purified cDNA and gene-specific primers for real-time PCR analysis in triplicate with the kit (TransStart Tip Green qPCR SuperMix, TransGen Biotech, Beijing, China). Finally, the number of cDNA was normalized to the abundance of 16S rRNA by the 2 -△△CT method and the relative quantitative method was used for LuxS signaling molecule gene analysis.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Gene-specific primers F (5'-GAATGTGGGCGTTAAGCAAACC-3'), R (5'-TGCACGTTCCTCATCACTATCG-3'). Use the purified cDNA and gene-specific primers for real-time PCR analysis in triplicate with the kit (TransStart Tip Green qPCR SuperMix, TransGen Biotech, Beijing, China). Finally, the number of cDNA was normalized to the abundance of 16S rRNA by the 2 -△△CT method and the relative quantitative method was used for LuxS signaling molecule gene analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!