Taqman snp assay

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom

The TaqMan SNP assay is a real-time PCR-based method for detecting and genotyping single nucleotide polymorphisms (SNPs) in DNA samples. It utilizes specific fluorescent probes and primers to target and amplify a DNA sequence containing the SNP of interest, allowing for accurate identification of the genetic variant.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

TaqMan assays (1810 citations) Custom TaqMan SNP Genotyping Assays (88 citations) TaqMan Pre-Designed SNP Genotyping Assays (67 citations) ABI TaqMan SNP genotyping assays (16 citations) TaqMan® SNP Genotype Assays (9 citations) TaqMan SNPs Genotyping Assays (5 citations) TaqMan SNP Predesigned Genotyping Assays (5 citations) TaqMan SNP Genotyping Assays probe (4 citations) Taqman SNP Genotyping Assay System (4 citations) TaqMan® SNP Genotyping Assay 20x (4 citations)

59 protocols using taqman snp assay

Genotyping with TaqMan Assays on qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping experiments were performed on StepOne Real Time Quantitative PCR (RT-qPCR) (Applied Biosystems, USA), using TaqMan reagents: TaqMan Genotyping Mastermix and TaqMan SNP Assays with their corresponding unique Assay IDs (rs205764: C:7614549_10; rs547311: C:2595518_10) (Life Technologies, USA). Fluorescence signals detected were VIC and FAM.
Preparation of the reaction mixture:
Each PCR tube contained a volume of DNA equivalent to at least 20 ng (manufacturer’s recommendation), nuclease-free water to 11.25 ul, 12.5 ul TaqMan Genotyping Mastermix, and finally, 1.25 ul TaqMan SNP Assay.
The standard thermal profile was used (Table 4).

Amin N.S., Abd El-Aziz M.K., Hamed M., Moustafa R.R, & El Tayebi H.M. (2023). Rs205764 and rs547311 in linc00513 may influence treatment responses in multiple sclerosis patients: A pharmacogenomics Egyptian study. Frontiers in Immunology, 14, 1087595.

+ Open protocol

+ Expand

Genotyping of SNPs in Plasma

Check if the same lab product or an alternative is used in the 5 most similar protocols

SNPs were determined in plasma by allelic discrimination using TaqMan SNP Assays (Life Technologies, Carlsbad, CA): Assay ID C_29168507_10 for rs7270101, and C_27465000_10 for rs1127354. Both SNPs were in Hardy–Weinberg equilibrium.

Waldenström J., Färkkilä M., Rembeck K., Norkrans G., Langeland N., Mørch K., Pedersen C., Rauning Buhl M., Nieminen U., Nuutinen H., Alsiö Å., Holmström L., Jungnelius R., Lund K., Rubensson A., Torell E., Westin J, & Lagging M. (2015). Short interferon and ribavirin treatment for HCV genotype 2 or 3 infection: NORDynamIC trial and real-life experience. Scandinavian Journal of Gastroenterology, 51(3), 337-343.

+ Open protocol

+ Expand

Vitamin D Receptor Polymorphisms Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polymorphisms were determined in serum by allelic discrimination real-time PCR using predesigned Taq-Man SNP Assays (Life Technologies, California USA) for rs7975232, rs2228570 and rs10877012 according to manufacturer’s instructions. rs7975232 (C>A) is also known as ApaI and located in the VDR gene. rs2228570 (C>T) is known as FokI, is also located in the VDR gene. rs10877012 (G>T) is located in the promotor region of the gene for CYP27B1.

Waldenström J., Nyström K., Nilsson S., Norkrans G., Ydreborg M., Langeland N., Mørch K., Westin J, & Lagging M. (2020). The relation of 25-hydroxy vitamin D concentrations to liver histopathology, seasonality and baseline characteristics in chronic hepatitis C virus genotype 2 or 3 infection. PLoS ONE, 15(8), e0237840.

+ Open protocol

+ Expand

MAPT p.A152T Genotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotypes were obtained using TaqMan® SNP assays from Life Technologies on a LightCycler® 480 System. A custom assay (#AHHR7R6) was designed for MAPT p.A152T rs143624519. Forward primer sequence was CCAATGGTGAAAAACCCCTCTATCA and reverse primer sequence was TTGGCCTGGCCCTTCTG. Reporter sequences were AAAACGAAGATCACCACACC and ACGAAGATCGCCACACC. p.A152T carriers were confirmed using Sanger sequencing. Statistical analysis was performed in R (version 3.1.3, www.r-project.org).

Lopez A., Lee S.E., Wojta K., Ramos E.M., Klein E., Chen J., Boxer A.L., Gorno-Tempini M.L., Geschwind D.H., Schlotawa L., Ogryzko N.V., Bigio E.H., Rogalski E., Weintraub S., Mesulam M.M., Fleming A., Coppola G., Miller B.L, & Rubinsztein D.C. (2017). A152T tau allele causes neurodegeneration that can be ameliorated in a zebrafish model by autophagy induction. Brain, 140(4), 1128-1146.

+ Open protocol

+ Expand

Targeted SNP Detection Using TaqMan Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

TaqMan® SNP assays were custom ordered from Life Technologies (Carlsbad, CA, USA). Each 40x assay consisted of two probes, one with a fluorophore and quencher while the other had only a non-florescent quencher (NFQ), referred to in this report as a “dark probe.” For 2851C>T (rs16947), two 40x assays were designed, i.e., T-FAM+C-dark and C-FAM+T-dark, allowing us to detect signal for either the “C” or “T” allele. For all other assays, VIC labeled probes were used. Another probe set for the CYP2D6*4 core SNP (1847G>A) was validated after the method was established for 2851C>T. DropPhase2D6 assay names, their TaqMan® assay IDs, and the SNP-specific probes labeled with fluorophores are shown in Table 1.

Boone E.C., Wang W.Y., Gaedigk R., Cherner M., Bérard A., Leeder J.S., Miller N.A, & Gaedigk A. (2020). Long-Distance Phasing of a Tentative “Enhancer” Single-Nucleotide Polymorphism With CYP2D6 Star Allele Definitions. Frontiers in Pharmacology, 11, 486.

+ Open protocol

+ Expand

APOE Genotyping from Buffy Coats

Check if the same lab product or an alternative is used in the 5 most similar protocols

Buffy coats were prepared from whole blood collected at the follow-up survey in 2012. DNA was purified from buffy coats using a QIA symphony DSP DNA Midi Kit (QIAGEN, Hilden, Germany) and stored at –80°C. Using TaqMan^® SNP Assays (Life Technologies, Carlsbad, CA), single nucleotide polymorphism genotyping of the APOEɛ4 allele (rs429358) was conducted. Individuals with at least one ɛ4 allele were determined as APOEɛ4 allele-positive carriers.

Okamoto N., Morikawa M., Amano N., Yanagi M., Takasawa S, & Kurumatani N. (2016). Effects of Tooth Loss and the Apolipoprotein E ɛ4 Allele on Mild Memory Impairment in the Fujiwara-kyo Study of Japan: A Nested Case-Control Study. Journal of Alzheimer's Disease, 55(2), 575-583.

+ Open protocol

+ Expand

Targeted Sequencing for Rare Variants in AVSD

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genes enriched for rare (including novel) and rare/damaging non-synonymous variants in AVSD cases vs. EVS controls on mutation burden analysis were selected for targeted sequencing in the replication cohort using Agilent Haloplex Custom Target Enrichment (Agilent Technologies Inc., Santa Clara, CA). A custom probe set was designed using Agilent SureDesign web-based software to target all coding exons for the prioritized genes (earray.chem.agilent.com/suredesign). Sequencing (100 bp paired-end reads, targeted at >200X coverage) was performed using Illumina HiSeq2500 (Illumina Inc., San Diego, CA) at The Centre for Applied Genomics (TCAG) in The Hospital for Sick Children. Agilent SureCall software was used to generate BAM files and perform variant calling. Variants were annotated and filtered using the same protocol as for the primary cohort. To assess the population frequency of the recurring variant in MDM4 [8:204518457 A>C (K324Q, rs41299595)], genotyping was performed in 97 Caucasian controls without heart disease from Ontario using a custom-designed TaqMan^® SNP Assays (Life Technologies Corporation) (Table S2.2). Samples were analyzed using the ViiA™ 7 Real-Time PCR System with ViiA™7 software.

D’Alessandro L.C., Al Turki S., Manickaraj A.K., Manase D., Mulder B.J., Bergin L., Rosenberg H.C., Mondal T., Gordon E., Lougheed J., Smythe J., Devriendt K., Bhattacharya S., Watkins H., Bentham J., Bowdin S., Hurles M.E, & Mital S. (2015). Exome Sequencing Identifies Rare Variants in Multiple Genes in Atrioventricular Septal Defect. Genetics in medicine : official journal of the American College of Medical Genetics, 18(2), 189-198.

+ Open protocol

+ Expand

Targeted Sequencing for Rare Variants in AVSD

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Genetic Predictors of Fertility

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood sampling and DNA extraction was performed for all patients prior to oocyte retrieval and laboratory staff and clinicians were blinded to the clinical results and genotyping. Blood sampling was performed in accordance with the treatment protocol and no extra venepunctures were performed beyond the standard treatment.
All blood samples were collected and stored at -80°C until the time of genotyping. Genomic DNA was extracted from peripheral leucocytes using the DNeasy blood and tissue extraction kit of Qiagen. Alternatively, conventional phenol/chloroform extraction, followed by ethanol precipitation was used.
The genotyping of the SNPs was carried out using the predesigned TaqMan SNP assays of Life Technologies for three SNPs from FSHR (c.919A>G (rs6165, in the National Center for Biotechnology Information (NCBI) SNPs database); c.2039A>G (rs6166); c.-29G>A (rs1394205)) and one SNP from FSHB (c.-211G>T (rs10835638)).

Polyzos N.P., Neves A.R., Drakopoulos P., Spits C., Alvaro Mercadal B., Garcia S., Ma P.Q.M., Le L.H., Ho M.T., Mertens J., Stoop D., Tournaye H, & Vuong N.L. (2021). The effect of polymorphisms in FSHR and FSHB genes on ovarian response: a prospective multicenter multinational study in Europe and Asia. Human reproduction (Oxford, England), 36(6).

+ Open protocol

+ Expand

LRRK2 p.G2019S Genotyping and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All subjects were screened for LRRK2 p.G2019S by Sanger sequencing or TaqMan SNP assays-on-demand (Life Technologies, Inc, Foster City, CA) and excluded for other pathogenic mutations implicated in PD. 19, 20 Subsequent genotyping was carried out by a combination of Sequenom MassArray iPLEX system (Sequenom, San Diego, CA) and TaqMan genotyping.
Cumulative incidence plots (Kaplan Meier) and hazard ratios (Cox proportional hazard regression models) were used to stratify age of initial symptom by genotypes using JMP® software (SAS Institute Inc., Cary, NC). These models were adjusted for family relatedness, gender and population series (Algeria, France, North America, Norway and Tunisia) (Table S10). Right censoring for asymptomatic carriers was performed at age of examination. Metaanalyses of all populations was performed with R-package 'metafor'.

Trinh J., Gustavsson E.K., Vilariño-Güell C., Bortnick S., Latourelle J., McKenzie M.B., Tu C.S., Nosova E., Khinda J., Milnerwood A., Lesage S., Brice A., Tazir M., Aasly J.O., Parkkinen L., Haytural H., Foroud T., Myers R.H., Sassi S.B., Hentati E., Nabli F., Farhat E., Amouri R., Hentati F, & Farrer M.J. (2016). DNM3 and genetic modifiers of age of onset in LRRK2 Gly2019Ser parkinsonism: a genome-wide linkage and association study. The Lancet. Neurology, 15(12).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!