The largest database of trusted experimental protocols

Plko 1 puro cmv turbogfp

Manufactured by Merck Group
Sourced in United States

PLKO.1-puro-CMV-TurboGFP is a plasmid vector that contains a puromycin resistance gene and a TurboGFP reporter gene under the control of a CMV promoter. It is designed for use in mammalian cell lines.

Automatically generated - may contain errors

4 protocols using plko 1 puro cmv turbogfp

1

Lentiviral Transduction of 3D Hepatocyte Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols
At 24 hours prior to transfection, HEK293T cells were plated in 6-well plate at 8 × 105 cells per well
in DMEM (10 % v/v FBS). Cells growing at ~70-80 % confluency were transfected with 1 μg of pLKO.1-puro-CMV-TurboGFP
(Sigma Aldrich) along with 2nd generation lentiviral packaging and envelope plasmids, 0.75 μg of psPAX2 and 0.25
μg of pMD.2g (gifts from D. Trono, Addgene #12260, #12259). At 36 hours post transfection, the media containing lentiviral
particles was collected and passed through a 0.45 μm filter. Polybrene was added to a final concentration of 4
μg/mL. 3D hepatocyte colonies released from matrigel were resuspended in expansion or EGF-induction media in ultra-low
attachment plate for lentiviral infection. The filtered media containing lentivirus was added at a 1:1 (v/v) dilution to target
hepatocyte organoids. A second infection was performed at 60 hours post transfection. GFP expression was visualized at 48 hours
after the first infection. For 2D visualization of hepatocytes, hepatocytes were transitioned to geltrex-coated 2D culture in
expansion media (2 % v/v FBS) at day 5 post second infection, and imaged 2 days later on a Leica DMI 600B microscope.
+ Open protocol
+ Expand
2

Organoid-based NK1-R expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
FACS sorted NK1-R and NK1-R+ cells were used to derive NK1-Rlow and NK1-Rhi, organoids, respectively (Figure S3A–D). NK1-Rlow and NK1-Rhi organoids were dissociated into single cells and transduced with lentiviral constructs containing pLKO.1-puro-CMV empty vector and pLKO.1-puro-CMV-TurboGFP (Sigma), respectively, as per manufacturer’s protocol. NK1-Rlow and NK1-Rhi/GFP organoids were plated as single cells at a 20:1 ratio (5×103 total cells/well) and imaged every 4 hours for 4 days in a microscope incubation chamber. NK1-Rlow and NK1-Rhi/GFP were plated at a 1:1 ratio (2×104 total cells/well) and subject to flow cytometry analysis at several time points.
+ Open protocol
+ Expand
3

Profilin 1 Knockdown in RPE1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To transiently knockdown Profilin 1 expression in RPE1 cells, a custom pLKO.1-puro-CMV-TurboGFP was purchased from Sigma-Aldrich, expressing a shRNA previously shown as efficiently targeting the CDS of PFN1 (5′- CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTT-3′)84 (link). As a negative control, the same pLKO-based plasmid expressing a non-target shRNA was purchased from Sigma-Aldrich and used. Stable RPE1 clones were generated through Nucleofection using the Amaxa Cell Line Nucleofector Kit V (VCA-1003), following the X-001 protocol provided by Amaxa Nucleofector (Lonza). After 24 h, clones stably expressing either the non-target or the PFN1 shRNA were selected with neomycin (0.5 mg/ml) every 60 h for 10 days. Single cell clones were picked and expanded; colonies from a single cell were then maintained with 0.4 mg/ml neomycin. Silencing was verified through western blotting. Three non-target (shControl) and five shPFN1 RPE1 clones were subjected to the experiments.
To conditionally silence PFN1, RPE1 cells expressing the doxycycline-inducible shRNA were cultured in medium containing 2.5 μg/ml doxycycline (Sigma-Aldrich, D9891), refreshing media every day for 7 days or for the time indicated in the figures.
+ Open protocol
+ Expand
4

Establishment of GFP-Expressing Pancreatic Cancer Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reagents. Rabbit polyclonal antibody to wide spectrum human cytokeratin (Ab9377) and mouse monoclonal antibody to GFP were purchased from Abcam (Cambridge, UK). Meyer's haematoxylin was used for nuclear counterstaining of the cells.
Cell lines. The SUIT-2 cell line was obtained from JCRB Cell Bank (Japanese Collection of Research Bioresources Cell Bank, Osaka, Japan), and was established from the liver metastasis of Japanese pancreatic cancer patients. The SUIT2-GFP cell line was established by the transfection of the SUIT-2 cell line with the GFP gene using the pLKO.1-puro-CMV-TurboGFP and puromycin selection (Sigma-Aldrich, St. Louis, MO, USA). Cell lines were maintained in Dulbecco's modified Eagle's medium containing 10% foetal bovine serum (GIBCO, Grands Islands, NY, USA) with 100 units/ml penicillin and 100 units/ml streptomycin sulphate and cultured in a humidified 5% CO 2 incubator at 37˚C.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!