ChIP was conducted using the SimpleChIP Chromatin IP kit (Cell Signaling Technology) in DLBCL cells (DOHH-2, HT, SU-DHL-8, HBL-1, DB, Karpas-422, SU-DHL-10, WSU-DLCL2, SU-DHL-6, and SU-DHL-4) according to the manufacturer’s protocol. Primers for the PRAME promoter region were designed according to the ENCODE transcription binding site as previously described (51 (link)). Real-time PCR was executed with purified DNA in the Power SYBR Green PCR system (Invitrogen) according to the manufacturer’s protocol.
Simplechip chromatin ip kit
Manufactured by Cell Signaling Technology
Sourced in United States
The SimpleChIP chromatin IP kit is a tool used for the immunoprecipitation of chromatin fragments. It provides a simplified workflow for the preparation and analysis of chromatin samples.
Automatically generated - may contain errors
Lab products found in correlation
Protein g magnetic beads, by Cell Signaling Technology (2 mentions)
Magna rip kit, by Merck Group (1 mentions)
Anti h3k27me3 ab6002, by Abcam (1 mentions)
Bromodeoxyuridine (brdu), by Merck Group (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Jbw301, by Merck Group (1 mentions)
Bioruptor u200, by Thermo Fisher Scientific (1 mentions)
Chip buffer, by Cell Signaling Technology (1 mentions)
Normal mouse igg, by Santa Cruz Biotechnology (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Camp assay kit, by R&D Systems (1 mentions)
Senescence β gal staining kit, by Cell Signaling Technology (1 mentions)
Horseradish peroxidase conjugated goat anti mouse igg, by Bio-Rad (1 mentions)
P pras40 thr246, by Cell Signaling Technology (1 mentions)
Horseradish peroxidase conjugated goat anti rabbit igg, by Bio-Rad (1 mentions)
Ecl western blot detection kit, by Cytiva (1 mentions)
Pmek1, by Santa Cruz Biotechnology (1 mentions)
P erk, by Santa Cruz Biotechnology (1 mentions)
Foxo3a, by Cell Signaling Technology (1 mentions)
C myc, by Santa Cruz Biotechnology (1 mentions)
9 protocols using simplechip chromatin ip kit
1
PRAME Promoter ChIP-qPCR Protocol
2
Chromatin Immunoprecipitation and RNA Immunoprecipitation in CD4+ T Cells
3
ChIP Analysis of RGS2 and HIF1α Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromotin immunoprecipitation (ChIP) was performed using SimpleChIP chromatin IP kit (Cell Signaling) according to the manufacturer's instructions. Briefly, cells were treated with formaldehyde solution, and the chromatin was isolated, digested, and immunoprecipitated with antibody against RGS2 or HIF1α. The captured chromatin was eluted, uncrosslinked, and the DNA was recovered. ChIP DNA was subject to PCR using specific primers flanking a piece of DNA sequence of MKP7 promoter region, which has binding sites for RGS2 or HIF1α.
4
Mapping Bivalent Chromatin Domains in Hematopoietic Cells
5
ChIP-PCR for SSX2, BMI1, H3K27me3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A375-TET-SSX2 cells were grown with 50-ng/ml DOX for 24 h to induce SSX2 expression. ChIP was done using the Simple Chip Chromatin IP kit (Cell Signaling) according to the recommendations of the manufacturer. Experiments were run in duplicate and repeated twice. Potential SSX2, BMI1 and H3K27me3 binding sites within promoters and transcription start sites of ATF3 (Chr1:212782257-212792953), SERPINB2 (Chr18:63887705-63903890) and TMEM27 (chrX: 15627316-15665031) genes were selected with the UCSC genome browser. ChIP-PCR primers are provided in Supplementary Information.
6
ChIP Assay for Chromatin Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using the SimpleChIP Chromatin IP kit (Cell Signaling Technology). Cells were crosslinked with formaldehyde (5 min) and quenched with glycine. Cell pellets were solubilized in ChIP buffer (Cell Signaling Technology) and sonicated (Fisher BioRuptor U200). Part of the supernatant was digested with proteinase K (65 °C for 2 h), the DNA isolated by spin columns, and input DNA quantified by real-time PCR. Equivalent amounts of chromatin were incubated with primary antibody (overnight at 4 °C for RPA, CtIP, and BLM and HA, 2 h at 4 °C for γH2AX) followed by protein-G magnetic beads (Cell Signaling Technology). Immune complexes were washed in low- and high-salt ChIP buffers (Cell Signaling Technology), eluted and incubated in NaCl (65 °C for 2 h), and then digested with proteinase K. Purified DNA was quantified by qPCR using the Step One Plus real time PCR system (Applied Biosystems). ChIP-grade antibodies included anti-HA magnetic beads (HA-7, Pierce), mouse anti-RPA34 (NA19L, Calbiochem), mouse anti-γH2AX (JBW301, Millipore), rabbit anti-CtIP (A300-487, Bethyl Labs), rabbit anti-BLM (A300-110, Bethyl Labs) and normal mouse IgG (Santa Cruz). The anti-RPA34 (NA19L, Calbiochem) and mouse anti-γH2AX (JBW301, Millipore) reagents have been used extensively for ChIP74 (link)75 (link). Primer sequences are listed in Supplementary Table 5 .
7
Comprehensive Molecular Profiling of Cellular Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The monoclonal antibodies against ADCY5, pmTOR(S2448), mTOR, pPRAS40 (Thr246), PRAS40, FoxO3a, LC3B, GSK-3β (S9P), IR, PCDNA and pJNK, senescence β-gal staining kit, and SimpleChIP chromatin IP kit were obtained from Cell Signaling (Beverly, MA, USA). Polyclonal antibodies against MKP7, RGS2, pEGFR, EGFR, pERK, ERK2, pMEK1, MEK1, IRS1, Cav2, cyclin D1, and c-myc were obtained from Santa Cruz Biotechnology (Dallas, TX, USA). The monoclonal antibodies against HIF1α, pAKT, and β-actin were obtained from Abcam (San Francisco, CA, USA). Horseradish peroxidase-conjugated goat anti-mouse IgG and horseradish peroxidase-conjugated goat anti-rabbit IgG were obtained from Bio-Rad (Hercules, CA, USA). Immunoblotting was performed using the ECL western blot detection kit (enhanced chemiluminescence; Amersham Biosciences, Amersham, UK). miRNA RT and PCR kits were obtained from Qiagen (Valencia, CA, USA). cAMP assay kit was obtained from R&D (Minneapolis, MN, USA).
8
Chromatin Immunoprecipitation of Zeb1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was carried out by using the SimpleChIP® Chromatin IP Kit (Cell Signaling) according to the manufacturer's instructions. Briefly, crosslinking was performed in cell culture medium containing 1% formaldehyde with gentle rotation for 10 min at room temperature. Fixation was stopped by the addition of glycine (125 mM final concentration). Fixed cells were then washed and digested by micrococcal nuclease. The nuclear pellet was suspended in chromatin immunoprecipitation (ChIP) buffer and sheared by sonication. The sheared chromatin was then immunoprecipitated with the Zeb1 antibody (Sigma‐Aldrich, HPA027524) or the control IgG (Cell Signaling), bound to the Protein G Magnetic Beads. The immunoprecipitated chromatins were then eluted with ChIP elution buffer. The DNA fragments were released by treatment of ribonuclease A and then proteinase K at 65°C for 2 h. The released DNA fragments were purified with columns and amplified by site‐specific primers by qPCR. Five percent of the chromatin extract was set aside for input. All ChIP signals were normalized to the input. The following Ckmt1 primers were used: 5′‐AAGCGCTTTTCCAAATTTCC‐3′ (sense) and 5′‐CCTGAGAAAGCTACTCTCCCTTT‐3′ (antisense).
9
CTCF ChIP-qPCR analysis of APH tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using the Simple Chip Chromatin IP Kit (Cell Signaling Technology) according to the manufacturer's instructions with several modifications. APH tissues were cross-linked with 1% formaldehyde for 10 min followed by the addition of 700 μl/sample of SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1) and sonicated for seven rounds of 10 pulses each with a Sonics Vibracell (maximal power 750 W; Sonics & Materials, Newtown, CT) at 30% maximal power to obtain 200-to 1000-bp fragments. Then, 100 μl of sheared chromatin sample mixed with 400 μl ChIP buffer was used for immunoprecipitation with antibodies directed against CTCF, 4 μg/sample (Diagenode, PRIDAB_2753160). DNA was isolated from each immunoprecipitate and subjected to real-time qPCR using the following primers (5′ → 3′). HSP25-E2 FWD-AGGCCATGTTCAGGGATGTC, REV-ATCTGGGGTCCCTCTCACA; SOCS3-E1 FWD-GACAC ATGGGCTCCAACATTT, REV-GATGTTGTTGGCTTCC TGCAA. The amount of immunoprecipitated DNA in each sample is presented as a signal relative to 1% of the total amount of input chromatin (cross-linked chromatin before immunoprecipitation).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!