The following primary antibodies were used: Anti-phospho-p38 (#9211), anti-p38 (#9212), anti-phospho-ERK1/2 (#4370), anti-E-Cadherin (#3195), anti-Snail (#4719) (all from Cell Signaling Technology, Frankfurt/Main, Germany), anti-HSP90 (both #sc-7947 and #sc-13119), anti-MKK6 (sc-6073), anti-TGF-β receptor I/ALK5 (V22, #sc-398), anti-TGF-β1 (3C11, #sc-130348) (all from Santa Cruz Biotechnology, Heidelberg, Germany), anti-ERK1/2 (#AF1576, R&D Systems, Wiesbaden, Germany) anti-Rac1b (#09-271, Merck Millipore, Darmstadt, Germany), anti-Rac1 (#610650), anti-Cip1/WAF1 (#610233) (both from BD Biosciences, Heidelberg, Germany), anti-β-actin (#A1978, Sigma, Deisenhofen, Germany). anti-Flag M2 (F3165, Sigma), HRP-linked anti-rabbit (#7074), anti-mouse (#7076) and anti-rat (#7077) secondary antibodies were from Cell Signaling Technology, anti-goat secondary antibody (#ab6741) was from Abcam (Cambridge, UK). Recombinant human (rh) TGF-β1 (#300-023) was purchased from ReliaTech (Wolfenbüttel, Germany) and used at a concentration of 5 ng/ml. The p38 inhibitor SB203580, the MEK1 inhibitor U0126 and the ALK5 inhibitor SB431542 were purchased from Calbiochem and used at a concentration of 10 μM (SB203580, UO126) and 5 μM (SB431542). Treatment of cells with these inhibitors for up to 48 h had no gross effect on cell viability.
Anti rac1
Manufactured by BD
Sourced in Germany, United States
Anti-Rac1 is a laboratory reagent used to detect and quantify the presence of the Rac1 protein in biological samples. It functions as a specific antibody that binds to the Rac1 protein, allowing for its identification and measurement.
Automatically generated - may contain errors
Lab products found in correlation
Anti rhoa, by Santa Cruz Biotechnology (5 mentions)
Anti β actin, by Merck Group (4 mentions)
Anti rac1b, by Merck Group (4 mentions)
Anti phospho erk1 2, by Cell Signaling Technology (3 mentions)
Anti cdc42, by BD (3 mentions)
Anti kras, by Santa Cruz Biotechnology (3 mentions)
Anti erk1 2, by R&D Systems (2 mentions)
Anti cip1 waf1, by BD (2 mentions)
Anti flag m2, by Merck Group (2 mentions)
Anti gm130, by BD (2 mentions)
Anti cdc42, by Santa Cruz Biotechnology (2 mentions)
Anti p53, by Cell Signaling Technology (2 mentions)
Anti α tubulin dm1a, by Merck Group (2 mentions)
E cadherin, by Thermo Fisher Scientific (2 mentions)
Anti cep192, by Merck Group (2 mentions)
Anti mcak, by Fortis Life Sciences (2 mentions)
Phospho ser15, by Cell Signaling Technology (2 mentions)
Anti p p53, by Cell Signaling Technology (2 mentions)
Imagequant las 4000, by GE Healthcare (2 mentions)
Anti β actin, by Santa Cruz Biotechnology (2 mentions)
31 protocols using anti rac1
1
Investigating EMT-related Signaling Pathways
2
Analysis of WAVE-Rac signaling components
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The antibodies used were: anti-PPP2R1A (Bethyl Laboratories, A300-962A, 1:2000); anti-NHSL1 (Sigma-Aldrich, HPA029967, 1:1000); anti-PP2Ac (Bethyl Laboratories, A300-732A, 1:3000); anti-GFP (Roche, 11814460001, 1:1000); anti-NCKAP1 (Bethyl Laboratories, A305-178A, 1:3000); anti-WAVE1 (R&D Systems, AF5514, 1:1000); anti-WAVE3 (R&D Systems, AF5515, 1:1000); anti-phospho-WAVE2 Ser308 (Millipore, 07-1511, 1:1000); anti-RAC1 (BD Biosciences, #610651, 1:500); anti-phospho-RAC1 Ser 71 (Cell Signaling Technology, #2461 T, 1:1000); anti-GAPDH (Thermo Fisher Scientific, AM4300, 1:4000); anti-β-actin (Thermo Fisher Scientific, AM4302, 1:4000); and anti-GM130 (#610823, BD Biosciences, 1:100). Home-made CYFIP1, ABI1, WAVE2 antibodies and BRK1 antibody were described previously5 (link),43 (link).
3
Antibody Protocols for Cell Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used commercial rat and mouse antibodies: anti-GFP (Nacalai), anti-HA (Roche Diagnostics, Cell Signaling), anti-Flotillin-1, anti-Caveolin-1, anti-Rac1, anti-GM130 (BD), horseradish peroxidase-conjugated IgG (Amersham Biosciences), and Alexa 488-, Alexa 555-, and Alexa 594-conjugated IgG (Molecular Probes).
4
Immunoblotting and RT-PCR for Rac GTPases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For immunoblotting, cells were lysed with 1xSDS lysis buffer (1% SDS and 60 mM Tris-HCl pH6.8) and sonicated for 20 seconds. Sixty μg of lysates were then applied to SDS-PAGE for immunoblot analysis. The target proteins were detected by their specific antibodies, including anti-HA (Santa Cruz), anti-Rac1 (BD Biosciences), anti-Rac2, anti-Rac3 (Abcam), anti-phospho-STAT3 Tyr705, anti-STAT3, anti-phospho-ERK1/2 Thr202/Tyr204, anti-ERK1/2, anti-Sox2 (Cell Signaling), anti-CD133 (Proteintech), anti-HIF-2α and anti-VEGF (Novas).
For RT-PCR, cells were subjected to RNA extraction using Trizol® (Invitrogen) according to the manufacturer's instructions. Two μg of total RNA were reverse transcribed by GoScript™ kit (Promega) and then 2 μl of cDNA were used for PCR reaction by GoTaq®Green Master Mix (Promega). Forward primer sequence for detecting Rac1-3 is 5’- CCTGAGGTGCGGCACCACTG −3’, and reverse primer sequences for Rac1-3 are 5’- GCAGGCATTTTCTCTTCC-3’, 5’-GGCTGCAGGC GCGCTTCTG-3’, and 5’-CGGTGCACTTCTTCCCC GG-3’, respectively.
For RT-PCR, cells were subjected to RNA extraction using Trizol® (Invitrogen) according to the manufacturer's instructions. Two μg of total RNA were reverse transcribed by GoScript™ kit (Promega) and then 2 μl of cDNA were used for PCR reaction by GoTaq®Green Master Mix (Promega). Forward primer sequence for detecting Rac1-3 is 5’- CCTGAGGTGCGGCACCACTG −3’, and reverse primer sequences for Rac1-3 are 5’- GCAGGCATTTTCTCTTCC-3’, 5’-GGCTGCAGGC GCGCTTCTG-3’, and 5’-CGGTGCACTTCTTCCCC GG-3’, respectively.
5
Purification and Manipulation of Wnt Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard recombinant DNA techniques were used to construct pCS2/FLAG-rat Fz2 (FLAG-Fz2) and pPGK-neo/Wnt5a. pSuper-retro-GFP-Neo-shWnt5a, which was used for the generation of cells stably expressing Wnt5a shRNA, was generated by inserting small hairpin RNA against Wnt5a (5′-GTGGATAACACCTCTGTT-3′) into the pSuper-retro-GFP-Neo vector (Oligo Engine, Seattle, WA). The small interfering RNAs (siRNAs) used in this study are listed in Table S1 . Wnt5a was purified to near homogeneity using three chromatography steps as described previously16 (link)55 (link). Anti-Wnt3a, anti-Wnt5a/b, anti-Src, anti-Fyn, anti-Yes, anti-phospho-Src family (Tyr416), anti-AKT, anti-phospho-AKT (Ser473), anti-phospho-PKC (pan) (Ser660), anti-SAPK/JNK, and anti-phospho-SAPK/JNK (Thr183/Tyr185) antibodies were purchased from Cell Signaling Technology (Beverly, MA). Anti-Rac1, anti-EEA1, anti-HSP90, anti-PKCα, and anti-Clathrin antibodies were from BD Biosciences (San Jose, CA). Anti-FLAG M2 and anti-Ror2 antibodies were from Sigma-Aldrich (Steinheim, Germany) and R&D Systems (Minneapolis, MN), respectively.
6
HUVEC Western Blot Analysis of Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVEC were lysed in RIPA buffer (as above) and proteins were separated in denaturing acrylamide gels and subsequently transferred to nitrocellulose membranes (Roche). After blocking with Roti® Block (Carl Roth) for 1 h, the membranes were probed with primary antibodies overnight at 4 °C followed by incubation with secondary antibodies. The immuno-reactive bands were visualized with enhanced chemiluminescence (Thermo Fischer Scientific) and then quantified by the densitometry analysis using AlphaEase FC software (Alpha Innotech). Following primary antibodies were used for western blots: anti-Epac1 (4155, Cell Signaling, 1:500), anti-Rap1 (sc-65, Santa Cruz, 1:200), anti-Rap1a/Rap1B (4938, Cell Signaling, 1:1000), anti-Rac1 (610650, BD Biosciences, 1:1000), anti-VEGFR-2 (2479, Cell Signaling, 1:1000), anti-γ-tubulin (T6557, Sigma-Aldrich, 1:5000). Following secondary antibodies were used for Western blot: Horseradish peroxidase conjugated anti-mouse (A9044, Sigma-Aldrich, 1:20,000), Horseradish peroxidase conjugated anti-rabbit (A9169, Sigma-Aldrich, 1:80,000).
7
Extraction and Quantification of Cellular Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To isolate cell lysates, culture medium was aspirated, and cells were washed with ice‐cold PBS. Cell lysis buffer (150 mM NaCl, 20 mM Tris (pH 7.5), 1mM EDTA, 1mM EGTA, 1% Triton X‐100, protease inhibitor cocktail: Complete Minitab, and phosphatase inhibitor cocktail: Complete PhoStop (Roche, Laval, Canada)) was then added to cells, and they were frozen at −20°C. Total protein was quantified using the Precision Red Protein Assay (Cytoskeleton, Denver, CO), and protein concentration was normalized between samples. Western blots were performed on normalized protein extracts from Caco‐2 intestinal epithelial cells. Membranes were probed with the appropriate primary antibody (anti‐RAC1, BD Bioscience #610651; anti‐β‐actin, Abcam #mAbcam‐8226) and corresponding horseradish peroxidase (HRP)‐conjugated secondary antibody. Membranes were imaged using the MicroChemi Bio‐Imaging system.
8
Measuring Small GTPase Activities
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RhoA, Rac1, and Cdc42 activities were assessed using the Rac1 and RhoA pull-down activation assay kit (Cytoskeleton, Inc., Denver, CO) according to the manufacturer’s instruction. In brief, cells were lysed in lysis buffer [50 mM Tris pH 7.5, 10 mM MgCl2, 0.5 mM NaCl, 2% NP-40, protease inhibitor cocktail (Cytoskeleton, Inc)] and the same amount (300–400 µg) of cell lysates was incubated with either 50 µg of PBD-GST or RBD-GST protein beads to precipitate activated Rac1 and Cdc42 or RhoA. Active (GTP-bound) and total Rac1, Cdc42, and RhoA were assessed by immunoblotting with anti-Rac1 (BD Bioscience), anti-Cdc42 (BD Bioscience), and anti-RhoA (Santa Cruz) antibodies. Relative levels of active versus total Rac1, Cdc42, and RhoA were quantified by densitometric analysis with image J (NIH) software. Experiments were repeated at least 4–5 times and the data was expressed as means ± S.E.M. ANOVA was used for multiple-group comparisons and the unpaired Student’s t test was used for two-group comparisons. Differences were considered statistically significant when P<0.05.
9
Antibody Dilutions for Protein Detection
10
Western Blot Analysis of Hepatic Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti‐RAC1 was from BD Biosciences (San Jose, CA), anti‐insulin receptor substrate 2 (IRS‐2) from Santa Cruz Biotechnology (Dallas, TX), anti‐insulin‐like growth factor 2 mRNA‐binding protein 1 (IGF2BP1) from Cell Signaling Technology (Danvers, MA), and anti‐β‐actin from Sigma‐Aldrich. Liver biopsy homogenate or IHH proteins were separated on 8, 10, or 12% Laemmli gels and transferred onto Protran® nitrocellulose (Fisher Scientific, Waltham, MA). Bound primary antibodies were detected with HRP conjugates (Jackson ImmunoResearch, West Grove, PA) and visualized by enhanced chemiluminescence (Thermo Scientific/Pierce, Rockford, IL). Signals were quantified by densitometry and normalized for β‐actin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!