Lipofectamie 2000

Cells grown in the 96-well plate were co-transfected with either empty vector or miR-216b and luciferase reporter comprising 3′UTR of FGFR1, wild type or mutant UCA1 fragment, using Lipofectamie 2000 (Invitrogen). Cells were harvested 48 h after transfection and luciferase activity was measured as chemiluminescence in a luminometer (PerkinElmer Life Sciences, Boston, MA, USA) using the Dual-Luciferase reporter assay system (Promega, Madison WI, USA) according to the manufacturer's protocol.

Human HEK293T cells (2.0 assays with a Molecular Imager) were co-transfected with 150 ng of either empty, pmir-GLO-NC, pmir-GLO-H19-wt or pmirGLO-H19-mut (Sangon biotech,China). Two ng of pRL-TK (Promega, Madison, WI, USA) were also co-transfected with miR-342-3p mimic or miRNA NC into HEK293T cells by using Lipofectamie 2000 (Invitrogen, USA). The relative luciferase activity was normalized to Renilla luciferase activity 48 h after transfection. Transfection was repeated in triplicate.

ZNF750 expression plasmid, a generous gift from Paul A. Khavari professor (Stanford University), was sub-cloned into the pcDNA3.1 vector with a HA tag and validated by sequencing and Western blot. The luciferase reporter plasmid of DANCR promoter with mutant or deleted ZNF750 binding site was constructed using pGL3-basic vector. The luciferase reporter plasmids of DANCR-wt, DANCR-mut, FOXC2-wt, FOXC2-mut were constructed using pSicheck2. The siRNA (RiboBio, Guangzhou, China) specific for DANCR or FOXC2 were used to knockdown DANCR or FOXC2, respectively. Transfections were performed using lipofectamie 2000 (Invitrogen, USA) following the manufacturer’s instructions. The siRNA for target genes, miR-4707-3p mimics and miRNA inhibitors were purchased from RiboBio (RiboBio, China). The lentivirus for stable expression or knockdown were constructed and packaged by GenePharma Co. (Shanghai, China). The siRNA sequences targeting specific genes are shown in Supplementary Table S1. Plasmids transfection was performed via the lipofectamine^TM 2000 transfection reagent (Invitrogen) according to the manufacturer.

To construct a luciferase reporter vector, GPR55 3′-UTR fragment containing putative binding sites for miR-675-5p was amplified by PCR using the following primers: h-GPR55-F: CCGACTCGAGCGGAAGGACATCCTGTTCAG h-GPR55-R: ATTGCGGCCGCCTTTCCAGAACCTCCCAGTC, the PCR product was subcloned downstream of the luciferase gene in the pLUC Luciferase vector (Ruibo, Guangzhou,China) and named GPR55-3′-UTR-WT. For the mutated construct, using the following primers: h-GPR55-mut-F: GGATGATGGCGTGGTTCTTCACTGATGTGCTTC. h-GPR55 -mut-R: GTGAAGAACCACGCCATCATCCCACCACATCA.
A549 cells grown in 96-well plate were co-transfected with 50 nM miR-675 mimic or mimic negative control, 100 ng of GPR55-3′UTR-Wt or GPR55-3′UTR-Mut, using the Lipofectamie 2000 (Invitrogen, USA). After 48 h of transfection, luciferase activity was assessed according to the Dual-Luciferase Reporter Assay protocol (Promega, Madison, WI). Each experiment was repeated in triplicates.

MDA-MB-453 cells were seeded in culture medium on 24-well plates, serum starved for 24 h. MDA-MB-453 cells were transfected with pGL4-AR-prom-Luc reporters along with plasmids using the Lipofectamie 2000(Invitrogen, USA) as indicated in the figures. After 48 h of transfection, cell lysates were subjected to luciferase assays according to the Dual-Luciferase Reporter Assay protocol (Promega, Madison, WI). Each experiment was repeated in triplicates.

Human HEK293T cells (2.0 × 10⁴) grown in a 96-well plate were co-transfected with 150 ng of either empty vector or miR-331-3p, miR-124, 50 ng of firefly luciferase reporter comprising 3’UTR of HER2, wild type or mutant HOTAIR fragment, and 2 ng of pRL-TK (Promega, Madison, WI, USA) using Lipofectamie 2000 (Invitrogen, USA). rno-miRNA-344 acts as a negative control. Cells were harvested 48 h after transfection for luciferase assay using a luciferase assay kit (Promega) according to the manufacturer’s protocol. Transfection was repeated in triplicate.

shRNA sequences including shNPRA-1: 5’- GCATTCTGATTGTCTCCTTCT-3’, shNPRA-2: 5’-GGGTTGTACTGAACTACAATG-3’ and a nonsense sequence shCTL: 5’-GTTCTCCGAACGTGTCACGT-3’ packaged in lentivirus vectors were designed and synthesized by GenePharma (Shanghai, China). The HIF-1α overexpression plasmid was synthesized into the GV362 vector (Genechem, China). Transfections were performed using lipofectamie 2000 (Invitrogen, USA) following the manufacturer’s instructions.