Log In Sign up
The largest database of trusted experimental protocols

Amplification primers

Manufactured by Thermo Fisher Scientific
Visit Supplier

Amplification primers are short DNA sequences used in various molecular biology techniques, such as polymerase chain reaction (PCR), to initiate the amplification of a specific target DNA sequence. They serve as the starting point for DNA synthesis, enabling the exponential multiplication of the target DNA.

Automatically generated - may contain errors

Lab products found in correlation

Superreal premix sybr green, by Tiangen Biotech (6 mentions) Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (6 mentions) Trizol, by Thermo Fisher Scientific (4 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Revertaid reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Clonexpress entry one step cloning kit, by Vazyme (1 mentions) Goscript reverse transcription system, by Promega (1 mentions) Q5 high fidelity 2 master mix, by New England Biolabs (1 mentions)

9 protocols using amplification primers

1

Gene Expression Analysis in Neural Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using TRIzol (Life Technologies) reagent and reverse-transcribed to cDNA using oligo(dT). Specific gene expression was quantified with SuperReal PreMix SYBR Green (TIANGEN) using an Applied Biosystems 7500 fast real-time PCR system (Life Technologies). The following amplification primers (Life Technologies) were used (5′ to 3′): GFAP (sense, ACATCGA GATCGCCACCTACA; antisense, GTCTGCACGGGAATGGTGAT), S100B (sense, GGAGACGGCGAATGTGACTT; antisense, GAACTCGTGGCAGGCAGTAGTAA), MAP2 (sense, GGGCCTTTTCTTTGAAATCTAGTTT; antisense, CAAA TGTGGCTCTCTGAAGAACA), TUBB3 (sense, GGCCAAGGGTCACTACACG; antisense, GCAGTCGCAGTTTTCACACTC), NEUN (sense, CCCATCCCGACTTACGGAG; antisense, GCTGAGCGTATCTGTAGGCT), GALC (sense, GCCAAGCGTTACCATGATTTG; antisense, CCACCTTGAAGAGTTCGGCA), MOG (sense, AGAACGCTACAGGCATGGAG; antisense, CAGGGCTCACCCAGTAGAAAG), NES (sense, CTGCTACCCTTGAGACACCTG; antisense, GGGCTCTGATCTCTGCATCTAC), SOX9 (sense, CGAAATCAACGAGAAACTGGAC; antisense, ATTTAGCACACTGATCACACG), PGC1α (sense, AAAGGATGCGCTCTCGTTCA; antisense, CTTCAGCCTCTCGTGCTGAT), PGC1β (sense, GAGGTGGACGAGCTCTCACT; antisense, GGGTGTCAGAGCTTGATGTT), and PRC (sense, CTTCCTGCCTACCCCACGTA; antisense, CTCCTGGGGAATGTCAACGC).
Xing F., Luan Y., Cai J., Wu S., Mai J., Gu J., Zhang H., Li K., Lin Y., Xiao X., Liang J., Li Y., Chen W., Tan Y., Sheng L., Lu B., Lu W., Gao M., Qiu P., Su X., Yin W., Hu J., Chen Z., Sai K., Wang J., Chen F., Chen Y., Zhu S., Liu D., Cheng S., Xie Z., Zhu W, & Yan G. (2017). The Anti-Warburg Effect Elicited by the cAMP-PGC1α Pathway Drives Differentiation of Glioblastoma Cells into Astrocytes. Cell reports, 18(2), 468-481.
+ Open protocol
+ Expand
2

Quantifying miR-1275 Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using TRIzol (Life Technologies, Thermo Scientific, Rockford, IL, USA) reagent and reverse‐transcribed to cDNA using a stem‐loop primer for miR‐1275 or a reverse primer for U6. Specific gene expression was quantified with SuperReal PreMix SYBR Green (TIANGEN, Beijing, China) using an Applied Biosystems 7500 fast real‐time PCR system (Life Technologies). The following amplification primers (Life Technologies) were used (50–30): miR‐1275 (stem‐loop primer, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGACAGCCT; sense, ACACTCCAGCTCAGGTGGGGGAGAGGCTGTC; antisense, CTCAACTGGTGTCGTGGAGTCGGCAATTCAG) and U6 (sense, CTCGCTTCGGCAGCACA; antisense, AACGCTTCACGAATTTGCGT).
Mai J., Gu J., Liu Y., Liu X., Sai K., Chen Z., Lu W., Yang X., Wang J., Guo C., Sun S., Xing F., Sheng L., Lu B., Zhu Z., Sun H., Xue D., Lin Y., Cai J., Tan Y., Li C., Yin W., Cao L., Ou‐yang Y., Qiu P., Su X., Yan G., Liang J, & Zhu W. (2019). Negative regulation of miR‐1275 by H3K27me3 is critical for glial induction of glioblastoma cells. Molecular Oncology, 13(7), 1589-1604.
+ Open protocol
+ Expand
3

Quantifying mtDNA in Human GBM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The level of mtDNA was measured by assessing the relative levels of mtDNA-ND1 to nDNA-B3M using a PCR analysis of total DNA extracted from human GBM cells. The following amplification primers (Life Technologies) were used (5′ to 3′): mtDNA-ND1 (sense, CCCTAAAACCCGCCACATCT; antisense, GAGCGATGGTGAGAGCTAAGGT) and nDNA-B3M (sense, TGCTGTCTCCATGTTTGATGTATCT; antisense: TCTCTGCTCCCCACCTCTAAGT).
Xing F., Luan Y., Cai J., Wu S., Mai J., Gu J., Zhang H., Li K., Lin Y., Xiao X., Liang J., Li Y., Chen W., Tan Y., Sheng L., Lu B., Lu W., Gao M., Qiu P., Su X., Yin W., Hu J., Chen Z., Sai K., Wang J., Chen F., Chen Y., Zhu S., Liu D., Cheng S., Xie Z., Zhu W, & Yan G. (2017). The Anti-Warburg Effect Elicited by the cAMP-PGC1α Pathway Drives Differentiation of Glioblastoma Cells into Astrocytes. Cell reports, 18(2), 468-481.
+ Open protocol
+ Expand
4

Gene Expression Analysis in Neural Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using TRIzol (Life Technologies) reagent and reverse-transcribed to cDNA using oligo(dT). Specific gene expression was quantified with SuperReal PreMix SYBR Green (TIANGEN) using an Applied Biosystems 7500 fast real-time PCR system (Life Technologies). The following amplification primers (Life Technologies) were used (5′ to 3′): GFAP (sense, ACATCGA GATCGCCACCTACA; antisense, GTCTGCACGGGAATGGTGAT), S100B (sense, GGAGACGGCGAATGTGACTT; antisense, GAACTCGTGGCAGGCAGTAGTAA), MAP2 (sense, GGGCCTTTTCTTTGAAATCTAGTTT; antisense, CAAA TGTGGCTCTCTGAAGAACA), TUBB3 (sense, GGCCAAGGGTCACTACACG; antisense, GCAGTCGCAGTTTTCACACTC), NEUN (sense, CCCATCCCGACTTACGGAG; antisense, GCTGAGCGTATCTGTAGGCT), GALC (sense, GCCAAGCGTTACCATGATTTG; antisense, CCACCTTGAAGAGTTCGGCA), MOG (sense, AGAACGCTACAGGCATGGAG; antisense, CAGGGCTCACCCAGTAGAAAG), NES (sense, CTGCTACCCTTGAGACACCTG; antisense, GGGCTCTGATCTCTGCATCTAC), SOX9 (sense, CGAAATCAACGAGAAACTGGAC; antisense, ATTTAGCACACTGATCACACG), PGC1α (sense, AAAGGATGCGCTCTCGTTCA; antisense, CTTCAGCCTCTCGTGCTGAT), PGC1β (sense, GAGGTGGACGAGCTCTCACT; antisense, GGGTGTCAGAGCTTGATGTT), and PRC (sense, CTTCCTGCCTACCCCACGTA; antisense, CTCCTGGGGAATGTCAACGC).
Xing F., Luan Y., Cai J., Wu S., Mai J., Gu J., Zhang H., Li K., Lin Y., Xiao X., Liang J., Li Y., Chen W., Tan Y., Sheng L., Lu B., Lu W., Gao M., Qiu P., Su X., Yin W., Hu J., Chen Z., Sai K., Wang J., Chen F., Chen Y., Zhu S., Liu D., Cheng S., Xie Z., Zhu W, & Yan G. (2017). The Anti-Warburg Effect Elicited by the cAMP-PGC1α Pathway Drives Differentiation of Glioblastoma Cells into Astrocytes. Cell reports, 18(2), 468-481.
+ Open protocol
+ Expand
5

Quantifying mtDNA in Human GBM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The level of mtDNA was measured by assessing the relative levels of mtDNA-ND1 to nDNA-B3M using a PCR analysis of total DNA extracted from human GBM cells. The following amplification primers (Life Technologies) were used (5′ to 3′): mtDNA-ND1 (sense, CCCTAAAACCCGCCACATCT; antisense, GAGCGATGGTGAGAGCTAAGGT) and nDNA-B3M (sense, TGCTGTCTCCATGTTTGATGTATCT; antisense: TCTCTGCTCCCCACCTCTAAGT).
Xing F., Luan Y., Cai J., Wu S., Mai J., Gu J., Zhang H., Li K., Lin Y., Xiao X., Liang J., Li Y., Chen W., Tan Y., Sheng L., Lu B., Lu W., Gao M., Qiu P., Su X., Yin W., Hu J., Chen Z., Sai K., Wang J., Chen F., Chen Y., Zhu S., Liu D., Cheng S., Xie Z., Zhu W, & Yan G. (2017). The Anti-Warburg Effect Elicited by the cAMP-PGC1α Pathway Drives Differentiation of Glioblastoma Cells into Astrocytes. Cell reports, 18(2), 468-481.
+ Open protocol
+ Expand
6

RNA Extraction and qPCR Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted with TRIzol reagent (Thermo Fisher) and reverse transcription was performed with oligo(dT) and RevertAid Reverse Transcriptase (Thermo Fisher) according to the manufacturer’s instructions. Quantitative PCR was performed with SuperReal PreMix SYBR Green (TIANGEN) in the Applied Biosystems 7500 Fast Real-Time PCR System (Life Technologies). The gene expression levels were normalized to those of β-actin and TBP-1. The amplification primers (Thermo Fisher) are listed in Supplementary Table 6.
Liang J., Guo L., Li K., Xiao X., Zhu W., Zheng X., Hu J., Zhang H., Cai J., Yu Y., Tan Y., Li C., Liu X., Hu C., Liu Y., Qiu P., Su X., He S., Lin Y, & Yan G. (2018). Inhibition of the mevalonate pathway enhances cancer cell oncolysis mediated by M1 virus. Nature Communications, 9, 1524.
+ Open protocol
+ Expand
7

Viral Genome Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from samples frozen during serial passaging, and reverse transcription was performed to synthesize cDNA according to the manufacturer’s instructions for the GoScript Reverse Transcription System (Promega). PCR was performed with Q5 High-Fidelity 2× Master Mix (NEB) and ten pairs of amplification primers (Thermo Fisher). The sequences of the primers are listed in Table S7. The PCR fragment amplified with primers 9936 and 11696 was inserted into a vector with a ClonExpress Entry One Step Cloning Kit (Vazyme). All PCR fragments were sequenced (Thermo Scientific) and then aligned with the M1-GFP sequence with Lasergene software 7.1.0.
Guo L., Hu C., Liu Y., Chen X., Song D., Shen R., Liu Z., Jia X., Zhang Q., Gao Y., Deng Z., Zuo T., Hu J., Zhu W., Cai J., Yan G., Liang J, & Lin Y. (2023). Directed natural evolution generates a next-generation oncolytic virus with a high potency and safety profile. Nature Communications, 14, 3410.
+ Open protocol
+ Expand
8

RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the TRIzol reagent (Life Technologies), and reverse transcribed to cDNA with oligo (dT). Gene expression was quantified using SuperReal PreMix SYBR Green (FP204-02, TIANGEN, Beijing, China) on an Applied Biosystems 7500 Fast Real-Time PCR system (Life Technologies). Expression of all genes were normalized to β-actin. The amplification primers (Thermo Fisher) are: IFIH1sense (TCACAAGTTGATGGTCCTCAAGT), IFIH1antisense (CTGATGAGTTATTCTCCATGCCC); IRF3 sense (AGA GGCTCGTGATGGTCAAG), IRF3 antisense (AGGTCC ACAGTATTCTCCAGG); IRF7 sense (CCCACGCTATAC CATCTACCT), IRF7 antisense (GATGTCGTCATAG AGGCTGTTG); IFIT1 sense (TTGATGACGATGAAA TGCCTGA), IFIT1 antisense (CAGGTCACCAGACTCC TCAC); IFNB sense (GCTTGGATTCCTACAAAGA AGCA), IFNB antisense (ATAGATGGTCAATGCGG CGTC); ZAP sense (TCACGAACTCTCTGGACTGAA), ZAP antisense (ACTTTTGCATATCTCGGGCATAA); M1 NS3sense (GGGGAGGGCTTTCTTTGTCA), M1 NS3antisenseCACCCTGTCTTGTCTTTGCTG); β-actin sense (GATCATTGCTCCTCCTGAGC), β-actin antisense (ACTCCTGCTTGCTGATCCAC).
Ying L., Cheng H., Xiong X.W., Yuan L., Peng Z.H., Wen Z.W., Ka L.J., Xiao X., Jing C., Qian T.Y., Liang G.Z., Mei Y.G., Bo Z.W, & Liang P. (2017). Interferon alpha antagonizes the anti-hepatoma activity of the oncolytic virus M1 by stimulating anti-viral immunity. Oncotarget, 8(15), 24694-24705.
+ Open protocol
+ Expand
9

Quantitative PCR Analysis of Immune Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using TRIzol (Life Technologies), and reverse transcription was performed from 3 μg total RNA using oligo(dt) and RevertAid Reverse Transcriptase (Thermo Scientific) according to the manufacturer’s recommendation. Quantitative PCR was performed with SuperReal PreMix SYBR Green (TIANGEN) using an Applied Biosystems 7500 Fast Real-Time PCR System (Life Technologies). All genes were normalized to β-actin. Amplification primers (Thermo Fisher) were as follows:
DNA-PKcs sense (AGCTGGCTTGCGCCATTT),
DNA-PKcs antisense (GGGCACACCACTTTAACAAGAC);
M1 NS1 sense (GTTCCAACAGGCGTCACCATC), M1 NS1 antisense (ACACATTCTTGTCTAGCACAGTCC);
M1 E2 sense (GTCACATACGGAAAGAGAGAACTG), M1 E2 antisense (CGGTCTATCCACTCCTCATACG);
IFIT1 sense (AGAAGCAGGCAATCACAGAAAA),
IFIT1 antisense (CTGAAACCGACCATAGTGGAAAT);
IFIT2 sense (GACACGGTTAAAGTGTGGAGG),
IFIT2 antisense (TCCAGACGGTAGCTTGCTATT);
IFIT3 sense (AAAAGCCCAACAACCCAGAAT),
IFIT3 antisense (CGTATTGGTTATCAGGACTCAGC);
IFNL1 sense (GGAGGCATCTGTCACCTTCA),
IFNL1 antisense (CCCTATGTCTCAGTCAGGGC);
IRF9 sense (GCCCTACAAGGTGTATCAGTTG), IRF9 antisense (TGCTGTCGCTTTGATGGTACT);
OASL sense (CCATTGTGCCTGCCTACAGAG),
OASL antisense (CTTCAGCTTAGTTGGCCGATG);
ACTB sense (GATCATTGCTCCTCCTGAGC),
ACTB antisense (ACTCCTGCTTGCTGATCCAC).
Xiao X., Liang J., Huang C., Li K., Xing F., Zhu W., Lin Z., Xu W., Wu G., Zhang J., Lin X., Tan Y., Cai J., Hu J., Chen X., Huang Y., Qin Z., Qiu P., Su X., Chen L., Lin Y., Zhang H, & Yan G. (2018). DNA-PK inhibition synergizes with oncolytic virus M1 by inhibiting antiviral response and potentiating DNA damage. Nature Communications, 9, 4342.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!