The largest database of trusted experimental protocols

5 protocols using adeno gfp

1

Immortalized Mouse Embryonic Fibroblast Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
SV40-LT-immortalized Trf1F/F and BlmF/F MEFs were described previously (Chester et al. 1998 (link); Sfeir et al. 2009 (link); Wu et al. 2012 (link)). MEFs were cultured in DMEM (Cellgro) supplemented with 100 U/mL penicillin (Gibco), 100 μg/mL streptomycin (Gibco), 0.2 mM L-glutamine (Gibco), 0.1 mM nonessential amino acids (Gibco), and 10% bovine calf serum (HyClone). Cre recombinase was introduced by two retroviral infections with Hit&Run Cre in pMMP at 12-h intervals. Adeno-GFP (Vector Biolabs 1060) and Adeno-Cre (Vector Biolabs 1700) were used as indicated in experiments that used Adeno-Cas9. In all experiments involving Cre or Cas9, cells were harvested 120 h after the initial introduction of the virus. Mouse Trf1 cDNA and the mutants were cloned into the pLPC-Myc-Puro or the pWZL-FLAG-Hygro vectors. MEFs infected with retroviral vectors were selected with 2.5 μg/mL puromycin or 135 μg/mL hygromycin for 3 d. shPold3 (TRCN0000279480) and a control shLuc (CGCTGAGTACTTCGAAATGTC) were cloned into the pLKO.1 vector. Spironolactone was purchased from Sigma (S3378), and CDK7i YKL-5-124 was from SelleckChem (S8863).
+ Open protocol
+ Expand
2

Conditional Knockout of miR21 in Calvaria

Check if the same lab product or an alternative is used in the 5 most similar protocols
Calvariae of miR21fl/fl mice were harvested at 5 days of age, and two 5‐mm pieces of the bone were removed using a biopsy punch (Integra LifeSciences Corporation, Plainsboro, NJ, USA). Samples were washed in PBS and incubated in a 96‐well plate with α‐minimal essential medium supplemented with 10% FBS and 1% penicillin/streptomycin for 6 h. Bones were then treated with 2.5 μL per well of control adenovirus (Adeno‐GFP, cat.#1060) or Cre‐recombinase virus (cat.#1700) (Vector BioLabs, Malvern, PA, USA) diluted in serum‐free α‐minimal essential medium in a final volume of 45 μL overnight. Next, media were removed and samples were washed twice with PBS before adding α‐minimal essential medium supplemented with 10% FBS and 1% penicillin/streptomycin and cultured for additional 48 h at 37% and 5% CO2. mRNA was quantified by qPCR and protein quantified by Western blotting.
+ Open protocol
+ Expand
3

MMTV-PyMT Organoid Cre-Lox Recombination

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prior to embedding in collagen I, freshly isolated MMTV-PyMT organoids were infected with adeno-Cre (Vector BioLabs, 1045) at an MOI of ~107 per 800 organoids. Infection was carried out in suspension, in 50 μL of DMEM-F12 overnight at 37° C. This typically yielded a recombination efficiency of 75–85%. Similar methods were followed for E-cad knockout in C3(1)-Tag tumor organoids. In this case, control organoids were treated with adeno-GFP (Vector BioLabs, 1060) using identical conditions.
+ Open protocol
+ Expand
4

Adenoviral and Lentiviral Transduction of Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Adeno-GFP (Vector BioLabs, Cat. No. 1060) or Adeno-LifeAct-GFP or -RFP (Ibidi, Cat. No. 60121 and 60122) were added after organoid isolation, prior to suspension in ECM. Isolated organoids were centrifuged in an Eppendorf tube at 520 g for 10 min. The supernatant was removed and organoids were resuspended in 100 μl DMEM-F12 (Gibco). Adenovirus was added at 5000-10,000 plaque-forming units per organoid to achieve gene expression in ~50 percent of cells. Organoids were incubated with virus for 1 h at 37°C and then washed twice with DMEM-F12 and suspended in ECM for plating. Lentiviruses encoding Raf1-(RBD)-GFP (Bondeva et al., 2002 (link); Sasaki et al., 2004 (link); Taylor and Shalloway, 1996 (link)) and PH-Akt-GFP (Addgene #51465) (Varnai and Balla, 1998 (link)) mixed at 100,000 PFUs with 3 μL of Viromag (OZ Bioscience, #RL400200) into 50 μL of DMEM-F12 and incubated for 30 min at RT. Organoids were plated at 1,500 orgs per well in a 96-well non-adherent plate (Thermo, #174907) and allowed to gravity settle for 30 min. Lentivirus was then mixed with organoids and incubated on top of a magnetic plate (OZ Bioscience, #MF10000) for 90 min and then incubated overnight at 37°C. Organoids are then washed twice with DMEM-F12, suspended in ECM, and plated.
+ Open protocol
+ Expand
5

MMTV-PyMT Organoid Cre-Lox Recombination

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prior to embedding in collagen I, freshly isolated MMTV-PyMT organoids were infected with adeno-Cre (Vector BioLabs, 1045) at an MOI of ~107 per 800 organoids. Infection was carried out in suspension, in 50 μL of DMEM-F12 overnight at 37° C. This typically yielded a recombination efficiency of 75–85%. Similar methods were followed for E-cad knockout in C3(1)-Tag tumor organoids. In this case, control organoids were treated with adeno-GFP (Vector BioLabs, 1060) using identical conditions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!